© 2007 European Society of Cardiology
Increased circulating concentrations and augmented myocardial extraction of osteoprotegerin in heart failure due to left ventricular pressure overload
a Wihuri Research Institute Helsinki, Finland
b The Transplantation Unit, Helsinki University Central Hospital Helsinki, Finland
c The Division of Cardiology, Helsinki University Central Hospital 00029 Helsinki, Finland
d The Division of Cardiothoracic Surgery, Helsinki University Central Hospital Helsinki, Finland
* Corresponding author. Tel.: +358 9 47172441; fax: +358 9 47174574. E-mail address: Markku.Kupari{at}hus.fi
| Abstract |
|---|
|
|
|---|
Background: Osteoprotegerin (OPG) and the receptor activator of nuclear factor-kB ligand (RANKL), two cytokines regulating bone remodeling, have recently been raised as potential pathogenetic factors in cardiovascular diseases. We have studied circulating and myocardial OPG and RANKL in patients having severe aortic stenosis (AS) with or without heart failure (HF).
Methods: We studied 131 adults with AS. Blood was sampled from the aortic root, coronary sinus, and femoral vein at cardiac catheterization. LV myocardial biopsies were taken at surgery. Plasma OPG and soluble (s)RANKL were analyzed by ELISA, and myocardial OPG and RANKL by RT-PCR and immunohistochemistry.
Results: Circulating OPG was elevated in AS patients with HF, the association being independent of age, sex, and presence of coronary artery disease (β=0.17, p=0.033). Elevated plasma OPG decreased after valve replacement in patients with preoperative HF (p=0.0005). Relative to its concentration in the aortic root, plasma OPG was reduced in the coronary sinus (p<0.05) and in the femoral vein (p<0.001), these arteriovenous gradients being accentuated in HF (p=0.003).
Conclusions: HF due to LV pressure overload in AS increases circulating OPG and augments OPG extraction by the heart and peripheral tissues. OPG may be involved in the pathogenesis of HF and could serve as a useful biomarker in HF due to LV pressure overload.
Key Words: Osteoprotegerin Heart failure Aortic stenosis
Received March 20, 2006; Revised June 26, 2006; Accepted October 4, 2007
| 1. Introduction |
|---|
|
|
|---|
Osteoprotegerin (OPG) and the receptor activator of nuclear factor-
B ligand (RANKL) are cytokines traditionally linked to the regulation of bone remodeling. RANKL activates osteoclasts and bone resorption, while OPG acts as a decoy receptor for RANKL inhibiting bone resorption [1,2]. As a member of the tumor necrosis factor (TNF) receptor family, OPG also modulates inflammatory responses and exerts antiapoptotic effects [3,4]. Interestingly, recent experimental, clinical, and epidemiological data have linked OPG and RANKL also to cardiovascular diseases [5-10]. Among other findings, plasma OPG has been shown to reflect the severity of coronary artery disease at angiography [7,8] and to predict the incidence of and mortality from cardiovascular diseases in the community [9]. The prognostic significance of OPG has been shown also in more selected cohorts like in elderly women [10] and in patients with postmyocardial infarction heart failure (HF) [11]. Recently, Ueland et al. showed that both the circulating concentration and the myocardial expression of OPG are elevated in HF due to dilated or ischemic cardiomyopathy [12]. In another cohort of dilated cardiomyopathy, OPG expression was elevated in LV myocardium but not in the circulation [13]. We set out to measure OPG and soluble (s)RANKL in plasma, and their gene expression in LV myocardium, in patients with severe AS with or without HF. In a subgroup of patients, the measurements were repeated after valve replacement. Our results add novel information about the responses of OPG and RANKL in LV pressure overload and further strengthen the role and the potential biomarker status of OPG in HF.
| 2. Methods |
|---|
|
|
|---|
2.1. Study population
The present study involved 131 adults with AS screened from a total of 174 consecutive patients referred for consideration of valve replacement [14]. Patients with past myocardial infarction, more than mild aortic or mitral regurgitation or previous cardiac surgery were excluded as were individuals with complicated diabetes and renal insufficiency (serum creatinine >170 µmol/l). All patients underwent echocardiography and cardiac catheterization with coronary angiography. The invasive and noninvasive methods and measurements have recently been described in full detail [14]. We used aortic valve area and mean gradient to describe the severity of AS and echocardiographic LV ejection fraction and mass to characterize LV systolic function and hypertrophy, respectively [14,15]. HF was diagnosed, following the European guidelines, when the patient reported effort dyspnea or fatigue (
NYHA 2) and had resting pulmonary wedge pressure
15 mm Hg at catheterization [16]. Angina pectoris was not taken as a symptom of HF. Table 1 summarizes the characteristics of the AS population.
|
2.2. Sampling of blood and heart muscle
Blood samples were collected from the femoral vein and aortic root in all patients (n=131), and from the coronary sinus in a subgroup of 49 individuals. This subgroup did not differ statistically significantly from the other patients with respect to age, sex, severity of AS, prevalence of HF or to any other patient characteristic (data not shown). Blood samples were drawn into EDTA tubes, put on ice and centrifuged within 30 min. Plasma was stored at –80 °C until analysis.
For control purposes, peripheral venous blood samples were taken from 39 individuals (20 men, 19 women) free of known structural heart disease. Their mean age (±SD) was 63±4 years (vs. 68±10 years in the AS group, p<0.01). Control blood samples for aortic and coronary sinus measurements were drawn from 12 subjects (6 women and 6 men, mean age 57±4 years) undergoing electrophysiological studies for tachyarrhythmias or unexplained syncope. They were free of signs of structural heart disease and had normal echocardiographic findings.
Samples of LV myocardium were obtained at surgery from 85 AS patients free of coronary artery disease at angiography. The biopsies were taken with a Tru-Cut needle from the anterior LV wall under direct visual control. Control samples of myocardium (n=11) were obtained from organ donors free of cardiovascular disease whose hearts could not be used as grafts. All myocardial samples were snap-frozen in liquid nitrogen and stored at –70 °C until analysis.
Postoperative venous blood samples were taken during control visits from 36 AS patients free of preoperative coronary artery disease a mean of 1.3 years after valve replacement. These patients also underwent follow-up echocardiographic studies to assess postoperative changes in LV structure and function.
The procedures of our work followed the principles outlined in the Declaration of Helsinki for human studies. The protocol was approved by the Ethics Committee of Helsinki University Central Hospital. All participants signed an informed consent document.
2.3. Enzyme immunoassays
Plasma concentrations of total OPG were determined by commercially available enzyme immunoassay (ELISA) (Biomedica, Vienna, Austria), which detects both monomeric and homodimeric forms of OPG, including OPG bound to its ligand. Plasma levels of sRANKL were analyzed by ELISA (Biomedica), which measures the free or unbound fraction of sRANKL. The intra- and interassay coefficients of variation were 7% and 7.5%, respectively, for OPG, and 4% and 7.5% for sRANKL. Plasma N-terminal B-type natriuretic peptide (Nt-proBNP) was measured by ELISA (Biomedica, Vienna, Austria) as described earlier [17]. All samples were measured in duplicate and averaged. If the duplicates differed more than 20%, the assay was repeated.
2.4. RT-PCR
Total RNA was isolated from the myocardial samples and subjected to RT-PCR analyses as described previously [18]. Sufficient mRNA was available for the present analyses from 58 AS patients and from all the 11 donor hearts. The following primers were used (from 5' to 3'): OPG: CCTCTCATCAGCTGTTGTGTG (F), TATCTCAAGGTAGCGCCCTTC (R); RANKL: TGGAGAGTCAAGATACAAAATTAATACC (F), TCAATCTATATCTCGAACTTTAAAAGCC (R); GAPDH: ACCACAGTCCATGCCATCAC (F), TCCACCACCCTGTTGCTGTA (R). The PCR products were verified, by DNA sequencing, to represent the corresponding target. The RT-PCR assay was standardized to the expression level of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The PCR products were quantified with a Gel Doc 2000 gel documentation system (Bio-Rad).
2.5. Immunohistochemistry
Immunohistochemistry of OPG and RANKL in frozen sections of myocardial samples was performed as described earlier [18]. OPG was detected with a goat-anti-human OPG antibody (1 µg/ml, R&D Systems) and RANKL with a monoclonal mouse-anti-human RANKL antibody (10 µg/ml, R&D Systems). The specificities of the primary antibodies were confirmed by the use of specific recombinant proteins (R&D Systems).
2.6. Statistical analysis
The data were analyzed for skewness and outliers both visually and using the Kolmogorov-Smirnov one-sample test. Comparisons across two or more groups were done with ANOVA (group means) or with the Kruskal-Wallis test (group medians). Associations between continuous variables were analyzed using Pearsons correlation coefficients. Grossly skewed data were log transformed before the analyses. The independent correlates of plasma OPG and sRANKL were analyzed using multiple linear regression analysis on explanatory factors showing univariate associations (p<0.05) with the dependent variables. ANOVA with repeated measurements incorporating one grouping factor and one within factor (sampling site) was used to compare OPG and sRANKL concentrations across the aortic root, coronary sinus and femoral vein. Repeated measurements' ANOVA was used also to compare plasma OPG and sRANKL before and after valve replacement (within factor) in AS patients with and without preoperative HF (grouping factor). Two-tailed p-values <0.05 were considered statistically significant. The data are summarized as mean±SEM or as median and range. All analyses were done using commercially available statistical software (SYSTAT Version 9.1, Systat Inc, USA).
| 3. Results |
|---|
|
|
|---|
3.1. Circulating OPG
Peripheral venous OPG averaged 4.0±0.2 pmol/l in patients with AS vs. 3.3±0.2 pmol/l in the control group (p=0.064 unadjusted and 0.599 when adjusted for the age disparity between the groups using ANOVA). Univariate analyses within the AS group showed that plasma OPG was directly related to age (r=0.38, p=0.00001), higher in women than in men (4.5±0.3 pmol/l vs. 3.6±0.3 pmol/l, p=0.021) and elevated in patients with HF (4.8±0.3 pmol/l vs. 3.7±0.2 pmol/l in the absence of HF, p=0.005) as well as in patients with coronary artery disease at angiography (4.7±0.3 pmol/l vs. 3.7±0.2 pmol/l in the absence of coronary artery disease, p=0.012). On the other hand, plasma OPG was unrelated to the severity of AS, presence of LV hypertrophy and any drug therapy. In multiple regression analysis, age (β=0.31, p=0.0008) and presence of HF (β=0.17, p=0.033) were the only independent determinants of plasma OPG. In keeping with the significance of HF, plasma OPG correlated directly with pulmonary wedge pressure (r=0.30, p=0.006), right atrial pressure (r=0.36, p=0.00003), and plasma Nt-proBNP (r=0.36, p=0.00004) (Fig. 1). Plasma OPG was unrelated to LV ejection fraction, however. Of note, most patients with HF had preserved LV systolic function (Table 1); ejection fraction averaged 52±2% vs. 64±1% in the presence and absence of HF, respectively (p=0.00001).
|
The determinants of plasma OPG were also analyzed separately in AS patients free of coronary artery disease at angiography (n=90). In this subgroup, too, plasma OPG was higher in patients with HF (n=25) than in patients free of HF (n=65) (4.8±0.5 pmol/l vs. 3.3±0.2 pmol/l, respectively, p=0.003). As in the total population, plasma OPG correlated with age (r=0.39, p<0.001) and was higher in women than in men (4.0±0.3 pmol/l vs. 3.1±0.2 pmol/l, respectively, p=0.011). In multivariate analysis, age (β=0.29, p=0.008) and presence of HF (β=0.28, p=0.006) were the independent determinants of plasma OPG also in the absence of coronary artery disease.
3.2. Circulating sRANKL
The median (range) peripheral venous sRANKL was 0.18 (<0.006-0.86) pmol/l in the AS patients vs. 0.15 (<0.006-0.94) pmol/l in the control group (p=0.11; one outlier sRANKL value of 6.5 pmol/l in the control group was excluded from the analysis). Univariate analyses within the AS group showed that sRANKL was inversely related to age (r=–0.22, p=0.013) and lower in the presence than in the absence of coronary artery disease (0.18±0.01 pmol/l vs. 0.24±0.02 pmol/l, p=0.014). sRANKL was unrelated to sex, severity of AS, presence of HF, presence of LV hypertrophy and drug therapy. A weak inverse relationship was found between the concentrations of sRANKL and OPG in the venous plasma (r=–0.22, p=0.012). Similar analyses restricted to AS patients free of coronary artery disease (n=90) yielded practically identical results: inverse relations of sRANKL with age (r=–0.24, p=0.020) and plasma OPG (r=–0.23, p=0.028) but no association with the other factors including HF.
3.3. Coronary and systemic arteriovenous gradients of OPG and sRANKL
Table 2 summarizes the concentrations of OPG and sRANKL in the aortic root, coronary sinus, and femoral vein in the AS and control groups. Fig. 2 extends the analysis by showing the data separately for patients with and without HF. Importantly, plasma OPG decreased from the aorta to the coronary sinus both in the control and AS groups (Table 2). In the AS patients, but not in the control group, an even more pronounced decrease of OPG concentration was observed from the aorta to the femoral vein (Table 2). The transcardiac OPG gradient (coronary sinus OPG minus aortic OPG) was inversely related to pulmonary wedge pressure (r=–0.43, p=0.002). The systemic arteriovenous OPG gradient (femoral vein OPG minus aortic OPG) was also inversely related to pulmonary wedge pressure (r=–0.29, p=0.050) and correlated directly with LV ejection fraction (r=0.32, p=0.030). Both the transcardiac and the systemic arteriovenous OPG gradients were statistically significantly augmented in HF (see Fig. 2 and its legend) but unrelated to age, sex, severity of AS, presence of LV hypertrophy and any drug therapy. The OPG gradients were also unrelated to the presence of coronary artery disease and the analyses were therefore conducted only in the total AS group.
|
|
Plasma sRANKL concentration increased from the aorta to the femoral vein particularly in the AS group but did not change from the aorta to the coronary sinus (Table 2). The magnitude of the aorta-to-femoral vein sRANKL gradient was unrelated to age, sex, severity of AS, presence of HF, presence of coronary artery disease, and use of drugs.
3.4. Postoperative changes in circulating OPG and sRANKL
The changes in venous OPG after aortic valve replacement differed by the preoperative HF status. Thus, patients with preoperative HF showed a mean postoperative change of –2.19±0.94 pmol/l whereas there was no change in plasma OPG (+0.19±0.19 pmol/l) in patients free of HF before surgery (p=0.0005 between group mean changes, Fig. 3A). Supporting the role of HF, the postoperative change of plasma OPG correlated with preoperative pulmonary wedge pressure and preoperative plasma Nt-proBNP as well as with the improvement of LV ejection fraction after surgery (Fig. 3B-D). Valve replacement had no influence on circulating sRANKL either in the whole group studied postoperatively (0.25±0.02 pmol/l vs. 0.26±0.02 pmol/l before and after surgery, respectively) or in the subgroup with preoperative HF.
|
3.5. OPG and RANKL expression in LV myocardium
OPG mRNA was detected in LV myocardium in all AS patients and in all healthy donor hearts. The means of mRNA quantity relative to GAPDH were 0.68±0.04 and 0.80±0.06 in the former and latter group, respectively (p=0.17). RANKL mRNA was detected much less often, in 41% of the myocardial samples in the AS group and in 18% of the control samples (p=0.09 for the group difference). Immunohistochemistry localized both OPG- and RANKL-positivity to cardiomyocytes and endothelial cells. The staining appeared more intense in the LV samples from the AS group (Fig. 4). The myocardial mRNA levels of both OPG and RANKL were unrelated to the severity of AS and to the presence of HF or LV hypertrophy. They were also unrelated to the use of drugs by the AS patients.
|
| 4. Discussion |
|---|
|
|
|---|
The present work adds to the growing evidence suggesting that OPG is a pathogenic player in cardiovascular diseases. The key observations are the following. 1) Circulating OPG is elevated in LV pressure overload-related HF in AS and decreases after valve replacement. 2) Both the heart muscle and the peripheral tissues extract OPG from the circulation, the extraction being most avid in patients with HF. 3) The elevation of circulating OPG and its increased extraction by the heart in AS-related HF are independent of concomitant coronary artery disease. 4) In contrast to OPG, circulating sRANKL shows no association with HF and is released into (rather than extracted from) the peripheral circulation.
Prior to our work, Ueland et al. [12] had studied OPG in HF, and found elevated circulating concentrations in patients with HF secondary to ischemic or dilated cardiomyopathy. Schoppet et al. [13], by contrast, observed unchanged plasma OPG in dilated cardiomyopathy, but their patients were primarily included for suspicion of myocardial inflammation and whether they had HF was not reported. Yet, both studies showed increased myocardial OPG expression in the dilated left ventricles [12,13]. Our work differed from these two studies by focusing on the effects of LV pressure overload. We found that plasma OPG was significantly increased in patients with AS-related HF and that the increase was proportional to the severity of venous congestion (pulmonary wedge pressure, right atrial pressure) and to neuroendocrine activation (Nt-proBNP) but not to LV systolic function. Importantly, the preoperatively increased OPG concentration decreased markedly with restoration of cardiac compensation following valve replacement. Unlike Ueland et al. [12] and Schoppet et al. [13], we did not observe increased myocardial expression of OPG mRNA in our patients with AS and HF. Although myocardial OPG synthesis was thus probably unaltered, the observed transcardiac OPG extraction may still have increased OPG content in the heart muscle. Indeed, immunohistochemistry suggested increased myocardial OPG in our patients (Fig. 4) in accord with the data reported by Ueland et al. [12].
The transcardiac drop of plasma OPG, indicating cardiac OPG extraction, is a fully novel finding. Observed even in structurally normal hearts, it was clearly most marked in the failing pressure overloaded hearts (Table 2, Fig. 2). The decrease of plasma OPG from the aorta to the femoral vein indicates that the peripheral tissues, too, extract OPG from the circulation. The mechanisms and significance of OPG extraction by the heart and peripheral muscle remain unknown. We emphasize that whether OPG is functional in cardiovascular diseases or merely a biomarker, and if functional, whether beneficial or harmful, has not yet been fully unveiled. Although OPG could in theory be protective against inflammatory responses [3,4] it may also have adverse effects on the cardiovascular structures [19].
The concentration of sRANKL in the circulation and the expression of RANKL mRNA in the heart muscle were unaltered in our patients with AS independent of the presence of HF. Ueland et al., by contrast, found increased plasma sRANKL and elevated myocardial RANKL in HF due to ischemic or dilated cardiomyopathy [12]. On the other hand, Schoppet et al. failed to find any myocardial RANKL by immunohistochemistry in their patients with dilated cardiomyopathy [13]. The data are, therefore, rather contradictory and the overall picture will remain unclear pending further studies.
Several limitations of our work need recognition. Without blood samples from additional vascular compartments, from pulmonary artery in particular, we were unable to localize the source of increased circulating OPG in HF. Nor could we study the mechanisms of cardiac and peripheral OPG extraction. Due to the small amounts of myocardial tissue available from LV biopsies we could determine myocardial OPG expression only by using mRNA determinations and immunohistochemistry. Postoperative OPG was not measured in all patients undergoing valve replacement. However, the participating subgroup was an unselected sample of survivors of surgery. Finally, the sRANKL ELISA method used by us, and also by Ueland et al. [12], measures only free sRANKL in the circulation, not sRANKL bound to OPG.
We conclude that circulating OPG and the extraction of OPG by the heart and peripheral tissues are increased in HF secondary to LV pressure overload in AS. Elevated OPG concentrations decrease after successful valve replacement in patients with preoperative HF. The association of circulating OPG with HF could in part explain why elevated OPG has been shown to predict increased cardiovascular mortality [9-11]. Notwithstanding its uncertain pathogenetic position, OPG has potential to serve as a risk factor and biomarker in cardiac diseases, particularly in HF.
| Acknowledgements |
|---|
This work was supported by the Finnish Foundation for Cardiovascular Research, Helsinki, Finland (SH); by the Sigrid Juselius Foundation, Helsinki, Finland; and by the EVO research funds of Helsinki University Central Hospital. Wihuri Research Institute is maintained by the Jenny and Antti Wihuri Foundation. We thank the transplantation team of the Finland Transplantation Unit for valuable work in collecting the control samples. We also acknowledge the excellent assistance of Mrs Liisa Blubaum, Mrs Elina Kaperi, Ms. Suvi Mäkinen, and Mrs Anna Oksaharju.
None of the authors has any conflicts of interest related to this work.
| References |
|---|
|
|
|---|
- Lacey D.L., Timms E., Tan H.L., et al. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell (1998) 93:165–176.[CrossRef][Web of Science][Medline]
- Hsu H., Lacey D.L., Dunstan C.R., et al. Tumor necrosis factor receptor family member RANK mediates osteoclast differentiation and activation induced by osteoprotegerin ligand. Proc Natl Acad Sci U S A (1999) 96:3540–3545.
[Abstract/Free Full Text] - Emery J.G., McDonnell P., Burke M.B., et al. Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J Biol Chem (1998) 273:14363–14367.
[Abstract/Free Full Text] - Yun T.J., Tallquist M.D., Aicher A., et al. Osteoprotegerin, a crucial regulator of bone metabolism, also regulates B cell development and function. J Immunol (2001) 166:1482–1491.
[Abstract/Free Full Text] - Bucay N., Sarosi I., Dunstan C.R., et al. Osteoprotegerin-deficient mice develop early onset osteoporosis and arterial calcification. Genes Dev (1998) 12:1260–1268.
[Abstract/Free Full Text] - Dhore C.R., Cleutjens J.P., Lutgens E., et al. Differential expression of bone matrix regulatory proteins in human atherosclerotic plaques. Arterioscler Thromb Vasc Biol (2001) 21:1998–2003.
[Abstract/Free Full Text] - Schoppet M., Sattler A.M., Schaefer J.R., Herzum M., Maisch B., Hofbauer L.C. Increased osteoprotegerin serum levels in men with coronary artery disease. J Clin Endocrinol Metab (2003) 88:1024–1028.
[Abstract/Free Full Text] - Jono S., Ikari Y., Shioi A., et al. Serum osteoprotegerin levels are associated with the presence and severity of coronary artery disease. Circulation (2002) 106:1192–1194.
[Abstract/Free Full Text] - Kiechl S., Schett G., Wenning G., et al. Osteoprotegerin is a risk factor for progressive atherosclerosis and cardiovascular disease. Circulation (2004) 109:2175–2180.
[Abstract/Free Full Text] - Browner W.S., Lui L.Y., Cummings S.R. Associations of serum osteoprotegerin levels with diabetes, stroke, bone density, fractures, and mortality in elderly women. J Clin Endocrinol Metab (2001) 86:631–637.
[Abstract/Free Full Text] - Ueland T., Jemtland R., Godang K., et al. Prognostic value of osteoprotegerin in heart failure after acute myocardial infarction. J Am Coll Cardiol (2004) 44:1970–1976.
[Abstract/Free Full Text] - Ueland T., Yndestad A., Oie E., et al. Dysregulated osteoprotegerin/RANK ligand/RANK axis in clinical and experimental heart failure. Circulation (2005) 111:2461–2468.
[Abstract/Free Full Text] - Schoppet M., Ruppert V., Hofbauer L.C., et al. TNF-related apoptosis-inducing ligand and its decoy receptor osteoprotegerin in nonischemic dilated cardiomyopathy. Biochem Biophys Res Commun (2005) 338:1745–1750.[CrossRef][Web of Science][Medline]
- Kupari M., Turto H., Lommi J. Left ventricular hypertrophy in aortic valve stenosis: preventive or promotive of systolic dysfunction and heart failure? Eur Heart J (2005) 26:1790–1796.
[Abstract/Free Full Text] - Devereux R.B., Lutas E.M., Casale P.N., et al. Standardization of M-mode echocardiographic left ventricular anatomic measurements. J Am Coll Cardiol (1984) 4:1222–1230.[Abstract]
- Swedberg K., Cleland J., Dargie H., et al. Guidelines for the diagnosis and treatment of chronic heart failure: executive summary (update 2005): The Task Force for the Diagnosis and Treatment of Chronic Heart Failure of the European Society of Cardiology. Eur Heart J (2005) 26:1115–1140.
[Free Full Text] - Kupari M., Turto H., Lommi J. Diagnosing heart failure in aortic valve stenosis. J Intern Med (2004) 256:381–387.[CrossRef][Web of Science][Medline]
- Helske S., Lindstedt K.A., Laine M., et al. Induction of local angiotensin II-producing systems in stenotic aortic valves. J Am Coll Cardiol (2004) 44:1859–1866.
[Abstract/Free Full Text] - Moran C.S., McCann M., Karan M., Norman P., Ketheesan N., Golledge J. Association of osteoprotegerin with human abdominal aortic aneurysm progression. Circulation (2005) 111:3119–3125.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
K Akat, M Borggrefe, and J J Kaden Aortic valve calcification: basic science to clinical practice Heart, April 1, 2009; 95(8): 616 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Wallis, S. Penckofer, and G. W. Sizemore The "Sunshine Deficit" and Cardiovascular Disease Circulation, September 30, 2008; 118(14): 1476 - 1485. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





