Skip Navigation

European Journal of Heart Failure 2007 9(1):15-22; doi:10.1016/j.ejheart.2006.04.008
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ye, L.
Right arrow Articles by Sim, E. K.W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ye, L.
Right arrow Articles by Sim, E. K.W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2006 European Society of Cardiology

Improved angiogenic response in pig heart following ischaemic injury using human skeletal myoblast simultaneously expressing VEGF165 and angiopoietin-1

Lei Yea, Husnain Kh. Haiderb,*, Shujia Jiangc, Ru San Tanc, Ruowen Ged, Peter K. Lawe and Eugene K.W. Sima

a Department of Surgery National University of Singapore-119074, Singapore
b National University Medical Institute National University of Singapore-117597, Singapore
c National Heart Centre, Singapore General Hospital Singapore
d Department of Biological Sciences, National University of Singapore Singapore
e Cell Therapy Research Foundation Memphis TN 38117-7126, USA

* Corresponding author. Department of Pathology and Laboratory Medicine, Medical Science Building, University of Cincinnati, Cincinnati OH 45220. E-mail addresses: haiderkh{at}UCMAIL.UC.edu, khhaider{at}hotmail.com


   Abstract
Top
 Abstract
1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
Objective: To achieve angiogenic interaction between VEGF165 and angiopoietin-1 (Ang-1) using a novel adenoviral bicistronic vector (Ad-Bic) encoding the two factors and delivered ex vivo using sex-mismatched human skeletal myoblasts.

Methods and results: A myocardial infarction model was developed in 29 female pigs; randomised into four groups: DMEM (group-1, n=6); Adenovirus null (Ad-null) vector-myoblast (group-2, n=5); Ad-Ang-1 myoblast (group 3, n=7) and Ad-Bic-myoblast (group-4, n=11). Three weeks later, 5 ml DMEM without myoblasts or containing 3 x 108 myoblasts carrying lac-z gene and transduced with Ad-null, Ad-Ang-1 or Ad-Bic were injected intra-myocardially in and around the infarct. 2D-echocardiography and fluorescent microsphere studies 6- and 12-weeks post-treatment revealed significantly improved cardiac performance and regional blood flow in groups 3 and 4. Histological studies and Y-chromosome analysis revealed extensive survival of lac-z positive myoblasts staining positive for human proteins in the pig heart. ELISA, immunostaining and RT-PCR revealed that Ad-Bic transduced myoblasts concomitantly but transiently expressed hVEGF165 and Ang-1 both in vitro and in vivo. Double fluorescent immunostaining of the tissue sections for vWFactor-III and smooth muscle actin showed significantly higher vascular density of mature blood vessels per low power microscopic field in groups 3 and 4 at 6- and 12-weeks.

Conclusion: Our combined approach led to enhanced angiogenesis with a greater percentage of functionally mature blood vessels in a porcine heart.

Key Words: Angiogenesis • Gene therapy • Infarction • Skeletal myoblast

Received June 14, 2005; Revised November 28, 2005; Accepted April 10, 2006


   1. Introduction
Top
 Abstract
 1. Introduction
2. Materials and methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
Therapeutic angiogenesis stimulates the development of new capillary network via medical intervention to compensate for coronary artery occlusion [1]. Experimental studies have shown that treatment with angiogenic factors promotes neovascularization in ischaemic tissues in animal models of progressive coronary occlusion as well as acute myocardial infarction [2-4]. Phase-I and II human studies have shown the safety of this approach on short term follow up; however, longer term safety and effectiveness still need to be ascertained [5-7]. Most studies involve single growth factor protein administration or use of a monocistronic gene delivery system. For complex biological processes such as angiogenesis, which involve a cascade of reactions controlled by multiple genes and their expression products, a single gene administration may be insufficient to achieve the desired effect. This has lead to increasing demand for bicistronic and polycistronic vectors to obtain multiple gene transfer [8-10]. Hence, a single growth factor administration may be insufficient to promote functionally effective neovascularization. Co-administration of VEGF and angiopoietin-1 (Ang-1) plasmid DNA has been shown to produce enhanced vascularization in the rabbit ischaemic hind limb model through a synergistic interaction between VEGF and Ang-1 [11]. Jones and colleagues co-administered naked DNA encoding for VEGF and Ang-1 to treat gastric ulcer in a rodent model [12]. In a recent study, Arsic et al. achieved functional neovascularization by combined administration of VEGF and Ang-1 gene using adeno-associated virus vectors [13]. We report the functional assessment of an adenoviral bicistronic vector (Ad-Bic), designed to carry and express genes encoding for human VEGF165 (hVEGF165) and Ang-1, driven by the same promoter. The vector was used for transduction of human skeletal myoblasts (HSM) which were later transplanted into a porcine myocardial infarction (MI) model to achieve angiomyogenesis for cardiac repair. We hypothesized that the co-expressed hVEGF165 and Ang-1, together with concomitant HSM transplantation may lead to better prognosis for the treatment of an infarcted heart.


   2. Materials and methods
Top
 Abstract
 1. Introduction
 2. Materials and methods
3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
2.1. Propagation and purification of Ad-Ang-1 and Ad-Bic
Ang-1 encoding adenoviral vector and a plasmid based bicistronic system with hVEGF165 and Ang-1 inserts and constructed into an adenoviral vector were kindly provided by Dr. Ge Ruowen, National University of Singapore. The bicistronic vector was an E1-deficient recombinant adenovirus carrying the hVEGF165 and Ang-1 genes separated by internal ribosomal entry site (IRES) region. Ad-Bic vector was propagated in 293-cells using Dulbeco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). At stipulated time the supernatant from 293-cells were collected, purified on cesium chloride gradient and used for transduction of myoblasts.

2.2. Skeletal myoblast culture
Skeletal myoblasts from human male donor skeletal muscle biopsies were provided by Cell Transplants Pvt Ltd. Singapore. Cells were manufactured according to an in-house Standard Operating Protocol with U.S. Patent No. 5,130,141 and Singapore Patent No. 34490 (WO 96/18303) licences. Cell production was in compliance with current Good Manufacturing Practice (cGMP) and International Organization for Standardization (ISO) Standard 9001 conditions. Briefly, prior to biopsy, the left rectus femoris muscle was preconditioned under local anaesthesia. Two days later, approximately 5 g of muscle tissue was harvested through a small skin incision. The harvested tissue was subjected to enzymatic digestion to generate myoblasts. The culture yielded up to 500 million HSM that were more than 99% pure by positive desmin immunostain and more than 99% viable according to vital dye exclusion tests. The cells were potent in myogenecity in that numerous myotubes were observed within three days in a fusion medium. Throughout the culture, the cells were negative for sterility (14-day test) and gram stain (absence of gram positive or negative bacteria) according to certified laboratory analyses. The purified HSM were cultured and propagated using in vitro cell culture flasks pre-coated with collagen, and using Super Medium (Cell Transplants Pvt Ltd Singapore) at 37 °C and 5% CO2 until the required number was obtained.

2.3. Flow cytometry
The percentage purity of HSM was assessed by flow cytofluorometry. After blocking, HSM or fibroblasts (as a control) were incubated in PBS with or without rabbit polyclonal anti-desmin antibody (1:200) (Sigma-USA). After washing, the samples were conjugated with FITC labelled anti-rabbit secondary antibody. Following re-suspension in PBS, cells were analyzed using a flow cytometer (Coulter-EPICS-USA) for percentage of desmin positive cells relative to the whole cell population.

2.4. Adenoviral transduction of skeletal myoblasts
HSM were cultured at 1x107 cell density in 225-mm2 tissue culture flasks. The cells were exposed to 1:1000 cell: virus ratios for 8 h. The viral infection medium was replaced with fresh growth medium for 24h. The transduction procedure was repeated three times to achieve optimum transduction efficiency.

2.5. Characterization of adenoviral vector transduced skeletal myoblasts in vitro
2.5.1. Fluorescent immunostaining
HSM transduced with Ad-Bic (Ad-Bic-myoblasts); Ad-Ang-1 or Ad-null were grown in glass chambers and fixed with –20 °C cold methanol. The cells were incubated at 37 °C with mouse anti-VEGF165 (BD Pharm. USA) and rabbit anti-Ang-1 primary antibodies (Chemicon Inc., USA). After washing, they were incubated with goat anti-mouse and goat anti-rabbit IgGs, conjugated with FITC and TRITC respectively, for 1 h (Sigma, USA). The myoblasts were visualized and counted in various microscopic fields for stained and unstained cells using a fluorescent microscope (Olympus, Japan).

2.5.2. Enzyme linked immunosorbent assay for hVEGF165
Supernatant samples from Ad-Bic-myoblast, Ad-null and non-transduced myoblasts were assessed using hVEGF165 Sandwich ELISA-kit (Chemicon Inc., USA). Supernatant samples from the respective growing cells were collected at regular intervals of two days, starting from day 1 after transduction, for up to 30-days and maintained at –20 °C until assay. The assay was performed according to the supplier's instructions using an ELISA plate reader (SLT-Lab Instruments, Australia).

2.5.3. RT-PCR for VEGF165 and Ang-1 gene expression
For in vitro studies, samples were collected from non-transduced, and from Ad-Null, Ad-Ang-1 or Ad-Bic transduced myoblasts on days 1, 8, 18 and 30, after transduction. For in vivo studies, pig heart tissue samples at 2- (one animal), 6-, and 12-weeks after HSM transplantation were collected from the remote, centre and peri-infarct regions. Total RNA was isolated using Total RNA Isolation-Kit (Qiagen-Germany) and RT-PCR was performed using QIAGEN One-step RT-PCR Kit (Qiagen-Germany). The primers for amplification of hVEGF165 were (forward) 5'ATGAACTTTCTGCTGTCTTGGGTG3'; (reverse) 5'TCACCGCCTCGGCTTGTCACA3'; for Ang-1 were (forward) 5'CGGTGAATATTGGCTGGGGAATGAG3'; (reverse) 5'GTAGTGCCACTTTATCCCATTCAG 3'; for human GAPDH were (forward) 5'-AGCCACATCGCTCAGACACC-3'; (reverse) 5'-GTACTCAGCGGCCAGCATCG-3'; and for pig GAPDH were (forward)5'-TTCCACGGCACAGTCAA 3', (reverse) 5'GCAGGTCAGGTCCACAA 3'.

2.6. In vivo studies
2.6.1. Animal groups and development of the animal model
Twenty-nine female swine, each weighing 30±5 kg, were used in the preparation of the animal model and divided into four treatment groups: group-1 (DMEM injected) n=6; group-2 (Ad-Null transduced myoblast transplanted) n=5; group-3 (Ad-Ang-1 transduced myoblast transduced myoblast transplanted) n=7; and group-4 (Ad-Bic transduced myoblast transplanted) n=11.

The animals were subjected to humane treatment. All animal procedures were carried out in accordance with the Institutional Protocols and Guidelines approved by National University of Singapore and the Institutional Animal Care and Use Committee (IACUC) Singapore General Hospital, and assisted by a veterinary doctor. The animals were anesthetized using isofluorane and the heart was exposed by a limited left side thoracotomy between the 4th and 5th intercostals space. Saline infusion was maintained throughout the procedure by intravenous line. The pericardium was incised and a branch of the left circumflex coronary artery (LCx) was ligated using a #4.0 polypropylene suture. The successful occlusion of the blood vessel was confirmed by coronary angiography. The chest was closed and animal was maintained on cephalosporin for 4-5 days for prophylactic treatment of wound infection.

2.6.2. Skeletal myoblast transplantation and transient immunosuppression
For post-transplant identification, HSM were transduced with a retroviral vector carrying lac-z gene with nuclear localization signal, kindly provided by Dr. Colin Porter (UK). Cell viability prior to transplantation was >99% as determined with 0.2% Trypan blue solution (Gibco-BRL). Three weeks after animal model preparation, the animal was prepared for a second left side thoracotomy as described earlier. HSM suspension in 5 ml basal DMEM containing 3x108 cells transduced with lac-z gene and either of Ad-null (group-2) or Ad-Ang-1 (group-3) or Ad-Bic (group-4) were injected at 20 different sites intra-myocardially in and around the infarct. In group-1 animals, 5 ml basal DMEM without myoblasts was injected. The animals received 5 mg/kg/day cyclosporine from 5-days prior to until 6-weeks after cell transplantation to induce transient immunosuppression.

The animals were euthanized at 2-weeks (group-3 n=1; group-4 n=1), 6-weeks (group-1 n=3; group-2 n=3; group-3 n=3; group-4 n=5) and 12-weeks (group-1 n=3; group-2 n=2; group-3 n=3; group-4 n=5) after treatment.

2.6.3. Histochemistry and immunohistochemistry
The animals were euthanized and heart was explanted and the cell injection site of the myocardium was sectioned into 5-mm cross sectional pieces along the longitudinal axis. Thin cryo-sections of 6-8 µm thickness were cut and stained for lac-z expression as described earlier. The lac-z positive tissue sections were immunostained using antibodies with specificity for human myosin heavy chain (fast isoform) (NeoMarkers, USA), human myosin heavy chain (slow isoform) (Chemicon Inc., USA), and porcine monocyte/granulocyte and CD3C (BD, Bioscience, USA).

For blood vessel density analysis, the tissue sections were immunostained for vonWillebrand factor VIII (vWFactor VII) as an endothelial cells marker and smooth muscle actin (SMA) using specific respective primary antibodies. The reactions of the primary antibodies were visualized using goat anti-rabbit IgG-TRITC (red fluorescence) and goat anti-mouse IgG-FITC (green fluorescence) conjugated secondary antibodies respectively and observed using an Olympus inverted microscope with fluorescent attachments (Olympus IX-70). Individual images for vWFactor VIII and smooth muscle actin were captured, followed by merging these images to obtain dual fluorescence in the same microscopic field to observe blood vessel maturation. Blood vessel density (number of blood vessels/microscopic field) measurement was carried out at low power microscopic field (x100) in 2-3 microscopic fields in 8-10 slides for each group of animals by a blinded observer.

2.6.4. PCR for human Y-chromosome in pig heart
Porcine heart tissue samples were collected at 2-, 6-, and 12-weeks after HSM transplantation. DNA was isolated from the samples according to manufacturer's instruction using DNeasy-Tissue Kit (QIAGEN, Germany). PCR for human Y-chromosome using TaqPCR Master Mix Kit (QIAGEN, Germany). Primers for PCR amplification of human Y-chromosome were (forward) 5'CATGAACGCATTCATCGTGTGGTC3', (reverse) 5' CTGCGGGAAGCAAACTGCAATTCTT 3'; primers for pig {gamma}-actin were (forward) 5'GGAAGCTCTGCATTGTGGAGT 3', (reverse) 5' TGTCGTTTTTCTGAGAACAGGG 3'.

2.6.5. Echocardiography
Echocardiography was performed using an ultrasound machine (Vingmed Vivid-5, General Electric), by an investigator who was blinded to the animal intervention procedures. Animals were anesthetized and kept in the right lateral position. From M-mode echocardiograms of the left ventricle (LV), measurements of the end-diastolic (ED), end systolic (ES) dimensions of the interventricular septum (IVS), left ventricular cavity and posterior wall (PW) were obtained. Fractional shortening (FS) and left ventricular ejection fraction (LVEF) were derived from FS=1–(LVES/LVED) and LVEF=1 (LVES/LVED)2.

2.6.6. Regional blood flow measurement
For regional blood flow (ml/minute/g) analysis, fluorescent microspheres (Molecular Probes, USA) were used [14]. Microspheres with three distinct fluorescent spectra were injected (1.4x104 microspheres/kg body weight), at week 0 (time of myoblast transplantation), and then at 6- and 12-weeks post-HSM transplantation. Arterial reference blood samples were obtained from external femoral artery at a constant rate of 10 ml/min. Animals were euthanized at stipulated time intervals and tissue samples and reference blood samples were processed to extract the fluorescent dye. The fluorescence activity was measured using a Perkin Elmer LS-50B spectrophotometer. Regional myocardial blood flow (Q, ml/min/g) was calculated as Q=(fl/flref)xR, where fl and flref are fluorescence of the tissue sample and the reference blood sample respectively, and R is the withdrawal speed of the arterial reference sample (ml/min).

2.7. Statistical analysis
Statistical analysis was performed using SPSS (version 11.0). All data were presented as mean±standard error means (SEM) and analyzed by analysis of variance (ANOVA). P<0.05 was considered statistically significant.


   3. Results
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
4. Discussion
 Appendix A. Supplementary data
 References
 
3.1. In vitro characterization
HSM culture was >99% pure for desmin expression. More than 95% Ad-Ang-1 myoblasts and Ad-Bic-myoblasts stained positive for Ang-1 and concomitant expression of hVEGF165 and Ang-1 respectively. ELISA revealed that Ad-Bic myoblasts continued to secrete hVEGF165 for >30-days post-transduction, with peak at day-8 (32±4 ng/ml). The persistent and high level of transgene expression complied with in vitro RT-PCR findings [data not shown].

3.2. In vivo studies
There were no animal deaths due to cell transplantation, supporting the safety of the procedure. We did not observe any micro- or macro-level tumour or angioma formation at 6- or 12-weeks post-HSM transplantation.

3.2.1. Skeletal myoblast survival in pig heart
Histochemistry revealed extensive survival of the lac-z positive HSM in the pig heart at 3 months after transplantation (Fig. 1a). This was further confirmed by PCR for human Y-chromosome in pig heart (Fig. 1b). Discontinuation of immunosuppression at week 6 produced no signs of myoblast rejection with no infiltration of the host immune cells at the site of the graft. The donor HSM expressed human skeletal muscle proteins in pig heart (Fig. 1c). The expression of Ang-1 and hVEGF165 was observed in vivo at the site of cell graft, but this had tapered off after 6-weeks of observation (Fig. 1d and e, see Appendix A).


Figure 01
View larger version (70K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 a) Histochemical staining for lac-z expression in the porcine cardiac tissue at 3 months after myoblasts transplantation (magnifications; a=400; b=oil immersion). b) PCR for in vivo expression of human Y-chromosome in pig heart tissue. Lane 1=DNA ladder Lane 2=Human myoblasts (positive control) Lanes 3,6,9,12=Centre of infarct Lanes 4,7,10,13=Peri-infarct Lanes 5,8,11,14=Remote from infarct. c) Immunostaining for human myosin heavy chain slow isoform expression in lac-z positive pig heart tissue. (magnification; 400x).

 
3.2.2. Blood vessel density
Dual fluorescent immunostaining for vWFactor VIII and SMA showed extensive neovascularization in the cell transplanted region in group-3 and group-4 (Fig. 2j-l, see Appendix A for Fig. 2a-i). Blood vessel density using immunostaining for vWFactor-VIII (mean±SEM) at 6- and 12-weeks at low power microscopic field (100x) was highest (45.2±2.95; 53.5±5.8) in group-4 as compared to group-3 (39.9±3.09 p=0.113 and 45.14±1.75 p=0.006); group-2 (26.57±2.09 p<0.005; 26.86±2.15 p<0.005) and group-1 (16.18±0.91 p<0.001; 13.44±0.9 p<0.001) (Fig. 2m). Normal pig heart blood vessel density was counted as the baseline measurement for comparison. Counter immunostaining for SMA for maturity index showed a significantly higher percentage of the newly formed vessels at 6-weeks developing into mature blood vessels at 12-weeks (staining positive for both vWFactor-VIII and SMA). At 12-weeks, more than 93.6±6.9% of the blood vessels in group-4 were mature as compared to 86.3±2.4% at 6-weeks (Fig. 2n, see Appendix A), thus indicating slow but progressive maturation of the newly formed capillary network under the synergistic influence of hVEGF165 and Ang-1. In group-3, the percentage of mature blood vessels increased from 85.3±2.9% at 6-weeks to 91.6±8.0% at 12-weeks post-HSM transplantation.


Figure 02
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 j-1: Double fluorescent immunostaining of pig cardiac tissue using vWFactor-VIII and SMA specific antibodies labelled with TRITC and FITC respectively, for blood vessel density analysis at 12-weeks after transplantation in the Ad-Bic myoblast group (magnification=100x). m Blood vessel density in the pig myocardium at 6- and 12-weeks after cell transplantation. Group 1=DMEM, Group 2=Ad-null, Group 3=Ad Ang-1, Group 4=Ad Bic.

 
3.2.3. Regional perfusion and left ventricular function studies
Regional blood flow improved from baseline (0.66±0.047; 1.0±0.083) in the centre and periphery of infarcted myocardium to (1.71±0.1; 2.91±0.07) at 6-weeks in group-4 as compared to group-1 (0.66±0.06 p<0.001 and 1.22±0.168 p<0.001) and group-2 (0.8±0.07 p<0.001 and 1.14±0.04 p<0.001) and group-3 (1.51±0.08 p>0.05 and 2.73±0.03 p>0.05) respectively (Fig. 3a-c). Significantly improved blood flow was consistently observed in group-4 (2.12±0.09 and 3.73±0.15) and group-3 (2.14±0.07 and 3.59±0.23) animals after 12-weeks both in the centre and periphery of the infarcted myocardium, but declined in group-1 (0.39±0.05 p<0.001; 0.98±0.04 p<0.001) and insignificantly improved in group-2 (1.0±0.06 p<0.001; 1.38±0.12 p<0.001) (Fig. 3a-c). Pre- and post-transplantation echocardiography was performed on selected animals (group 1, n=6; group 2, n=5; group 3, n=6 and group 4, n=6, at baseline and 6-weeks) and compared between times and between the control and experimental animal groups. Major functional results are summarized in Fig. 4a-c. LVEF and FS in group-1 declined from (40.86±8.61%; 23.28±4.5%) to (36.84±3.02%; 20.46±1.83%) respectively. However, a significant improvement in LVEF and FS was observed at 6-weeks in group-4 (41.35±2.28%; 25.23±.1.71%) to (50.56±2.24% p=0.004; 29.82±1.57% p=0.006) as compared with group-2 (37.82±3.64%; 22.0±2.84%) to (44.17±3.55% p=0.108; 24.92±2.55% p=0.176) and group 3 (41.57±6.13%; 25.33±4.09%) to (49.22±5.92% p=0.037; 29.24±4.21% p=0.04) (Fig. 4a-b). Assessment of LV end diastolic diameter (LVEDD) was performed as a marker of LV remodelling. At baseline, LVEDD (mm) was (40.64±3.49) in group-1, (44.94±1.45) in group-2, (42.7±1.3) in group-3 and (40.61±2.34) in group-4. After 6-weeks of cell transplantation LVEDD increased in all animal groups (group-1 45.33±3.89 p=0.043; group-2 48.35±1.86 p=0.009; group-3 45.8±1.2 p=0.015 and group-4 43.39±1 p=0.204) (Fig. 4c). However, the greatest increase in LVEDD was observed in the DMEM group (11.54%) and the smallest increase was observed in group-4 (6.85%).


Figure 03
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Blood flow studies in the pig myocardium using fluorescent microspheres at (a) Centre of infarct (b) peri-infarct (c) remote from the infarct regions. Group 1=DMEM, Group 2=Ad-null, Group 3=Ad Ang-1, Group 4=Ad Bic. *vs Ang-1 myoblast and Bic-myoblast groups at 6 and 12 weeks after treatment: p<0.05.

 


Figure 04
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 Heart function assessment of porcine heart using 2D-echocardiography (a) Left ventricular ejection fraction and (b) Fractional shortening (c) LV end diastolic dimension. Group 1=DMEM, Group 2=Ad-null, Group 3=Ad Ang-1, Group 4=Ad Bic.

 

   4. Discussion
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
Appendix A. Supplementary data
 References
 
Most of the studies in animal models and patients to achieve therapeutic angiogenesis have involved the delivery of a single protein or gene encoding for one angiogenic growth factor [2-8]. Xiao and colleagues have reported a bicistronic vector encoding for bFGF together with GFP reporter gene [15]. There is no information about one vector carrying two growth factor genes for therapeutic angiogenesis.

The development of stable and functional blood vessels requires several pro- and anti-angiogenic factors and vascular modulators which stimulate vessel sprouting and remodelling through co-ordinated targeting of various cells. Hence, a therapeutic strategy based on a single angiogenic factor may be inefficient and lead to the formation of morphologically and architecturally deficient and unstable blood vessels. In addition, studies have shown that uncontrolled and up-regulated expression of a single growth factor can cause complications [16,17].

Sequential use of growth factors in various combinations such as VEGF and bFGF, PDGF and bFGF, VEGF and Ang-1 has been shown to result in angiogenic synergism [11-13,18]. The mechanism underlying the outcome of combined angiogenic growth factor administration is complex and may vary for each combination [18]. In the case of Ang-1 and VEGF, Ang-1 suppresses the expression of adhesion molecules and reduces basal and VEGF-induced permeability, and counteracts VEGF-induced inflammation in endothelial cells with an additive effect on vessel formation [19,20]. Both VEGF and Ang-1 are potent angiogenic factors and their cooperative role has been implicated in blood vessel formation [21-23].

Besides concomitant hVEGF and Ang-1 gene expression, another important feature of our study is the combination of gene therapy with cell transplantation. The feasibility of this approach has already been documented by us and others [24-26]. Furthermore, cell based angiogenic gene delivery provides a safer alternative to the direct injection of adenoviral vector constructs [27]. In these studies, although encouraging data has been produced on shorter-term basis, longer term effects of this promising modality remain to be ascertained. Our findings may provide impetus to the concept of angiogenic synergism using polycistronic vectors to induce functionally stable vessels.

The selection of a porcine heart model of coronary artery ligation was made due to its relevance in the clinical perspective. LCx coronary artery branch occlusion was chosen as the method for infarct modelling because the artery is accessible. In our experience, animal survival has been good with this method. On echocardiography, the resulting infarcted lateral wall was not well visualized, owing to limited acoustic window access (the pig heart occupies a more central mediastinal position compared to the human, and is thus situated further away from the chest wall). This problem was compounded as the study pigs grew in size. Due to this technical limitation, we were not able to characterize regional wall motion consistently in all experimental animals included in the study. As an alternative, we chose to study the effect of the infarct on global LV-function, and LV-remodelling, using M-mode derived indices, which could be obtained easily in the experimental animals.

The results of our study highlight the successful transduction of HSM with an Ad-Bic carrying both hVEGF165 and Ang-1 genes with simultaneous and high level expression. An important feature of our study is the use of HSM xenograft with transient use of cyclosporine. We witnessed excellent survival of the donor HSM at the site of injection until 12-weeks post-transplantation without any evidence of rejection (Fig. 1a). Immunostaining for immune cell infiltration showed a lack of host immune response (data not shown). We have previously shown that transient immunosuppression may lead to longer term survival of the donor HSM [26,28]. The survival of HSM was further confirmed by in vivo expression of human Y-chromosome, VEGF, and Ang-1 at the injection site (Fig. 1b, d and e, see Appendix A for Fig. 1d and e).

Another interesting observation was the enhanced blood vessel density at the injection site. Dual fluorescent immunostaining for vWFactor-VIII and SMA showed that at 6-weeks post-HSM transplantation, there was a significant increase in the vessel density in group-3 and group-4 as compared to the control groups-1 and 2. At 12-weeks, the vessel density further improved with a concomitantly enhanced maturity index (Fig. 2n, see Appendix 1). We have previously reported potent stimulation of nascent vascular network formation in a pig MI model after transplantation of HSM transduced with Ad-hVEGF165 [26]. Quantitative assessment of vascular density at 6-weeks revealed 57.13±4.2 blood vessels per low power microscopic field (x100) which declined to 32.1±1.74 at 12-weeks in Ad-hVEGF165 vector transduced HSM transplanted animals. Contrary to these findings, in the present study, blood vessel density at 6-weeks was 45.2±2.95 which increased to 53.5±5.87 in group-4. These results clearly show that hVEFG165 transduced HSM transplantation stimulated angiogenesis which mostly involved unstable blood vessel conduits, some of which failed to mature and regressed over time.

When immunostained for SMA for maturity index, a significantly higher percentage of the newly formed vessels at 6-weeks had developed into mature blood vessels at 12-weeks (staining positive for both vWFactor-VIII and SMA). At 12-weeks, more than 93% of blood vessels were mature (with smooth muscle cell covering) in group-4 as compared to 86% at 6-weeks, thus indicating slow but progressive maturation of the newly formed capillary network under the synergistic influence of hVEGF165 and Ang-1. Contrary to this, the results of our previous study [26] showed that the percentage of mature blood vessels in hVEGF165 transduced HSM transplanted animals increased from 35.4% at 6-weeks to 90.6% at 12-weeks. Although there was a progressive increase in the blood vessel maturation, this may be attributed to regression of the blood vessel conduits formed under the influence of hVEGF165 stimulus (from 57.13±4.2 at 6-weeks to 32.1±1.74 at 12-weeks) which failed to mature over the time due to the lack of proper signals. Thus, co-expression of Ang-1 in the present study helped the nascent blood vessels to form functionally mature blood vessels which resulted in enhanced regional blood flow (Fig. 3a-c) and an overall improved cardiac function (Fig. 4a-c).

In conclusion, we have demonstrated successful transduction of HSM with a novel adenoviral bicistronic vector expressing human genes encoding for VEGF165 and Ang-1 for concurrent application of cell transplantation and angiogenesis. The novel bicistronic vector achieved combined angiogenic effects of VEGF and Ang-1 and may provide a novel strategy for the treatment of ischaemic heart or limb diseases.


   Appendix A. Supplementary data
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
References
 
Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ejheart.2006.04.008.


   Acknowledgements
 
This work was carried out at the National University of Singapore and Department of Experimental Surgery, Singapore General Hospital and supported by NMRC (Singapore) Grant#R-364-000-017-213 and IBG-NUMI Cardiovascular Research Program R364-000-021-213.


   References
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 

  1. Freedman S.B., Isner J.M. Therapeutic angiogenesis for coronary artery disease. Ann Intern Med (2002) 136:54–71.[Abstract/Free Full Text]
  2. Lopez J.J., Laham R.J., Stamler A., et al. VEGF administration in chronic myocardial ischemia in pigs. Cardiovasc Res (1998) 40:272–281.[Abstract/Free Full Text]
  3. Suri C., McClain J., Thurston G., et al. Increased vascularization in mice overexpressing angiopoietin-1. Science (1998) 282:468–471.[Abstract/Free Full Text]
  4. Duan H.F., Wu C.T., Wu D.L., et al. Treatment of myocardial ischemia with bone marrow-derived mesenchymal stem cells over expressing hepatocyte growth factor. Mol Ther (2003) 8:467–474.[CrossRef][Web of Science][Medline]
  5. Vale P.R., Losordo D.W., Milliken C.E., et al. Left ventricular electromechanical mapping to assess efficacy of phVEGF165 gene transfer for therapeutic angiogenesis in chronic myocardial ischemia. Circulation (2002) 102:965–974.
  6. Henry T.D., Annex B.H., McKendall G.R. VIVA Investigators. The VIVA trials VEGF in ischemia for vascular angiogenesis. Circulation (2003) 107:1359–1365.[Abstract/Free Full Text]
  7. Simons M., Bonow R.O., Chronos N.A., et al. Clinical trials in coronary angiogenesis: issues, problems consensus. Circulation (2000) 102:e73–e86.[Web of Science][Medline]
  8. de Felipe P. Polycistronic viral vectors. Curr Gene Ther (2002) 2:355–378.[CrossRef][Medline]
  9. Tsuchiyama T., Kaneko S., Nakamoto Y., et al. Enhanced antitumor effects of a bicistronic adenovirus vector expressing both herpes simplex virus thymidine kinase and monocyte chemo-attractant protein-1 against hepatocellular carcinomas. Cancer Gene Ther (2003) 10:260–269.[CrossRef][Web of Science][Medline]
  10. Ciafre S.A., Barillari G., Bongiorno-Borbone L., Wannenes F., Izquierdo M., Farace M.G. A tricistronic retroviral vector expressing natural anti-angiogenic factors inhibits angiogenesis in vitro, but is not able to block tumor progression in vivo. Gene Ther (2002) 9:297–302.[CrossRef][Web of Science][Medline]
  11. Shyu Kou-Gi, Chang Hang, Isner Jeffrey M. Synergistic effect of angiopoietin-1 and vascular endothelial growth factor on neo-angiogenesis in hyper-cholesterolemic rabbit model with acute hind limb ischemia. Life Sci (2003) 73:563–579.[CrossRef][Web of Science][Medline]
  12. Jones M.K., Kawanaka H., Baatar D., et al. Gene therapy for gastric ulcers with single local injection of naked DNA encoding VEGF and angiopoietin-1. Gastroenterol (2001) 121:1040–1047.[CrossRef][Web of Science][Medline]
  13. Arsic N., Zentilin L., Zacchigna S., et al. Induction of functional neovascularization by combined VEGF165 and Ang-1gene transfer using rAAV vectors. Mol Ther (2003) 7:450–459.[CrossRef][Web of Science][Medline]
  14. Schalch P., Rahman G.F., Patejunas G., et al. Adenoviral-mediated transfer of vascular endothelial growth factor 121 cDNA enhances myocardial perfusion and exercise performance in the nonischemic state. J Thorac Cardiovasc Surg (2004) 127:535–540.[Abstract/Free Full Text]
  15. Xiao L., Liu P., Sobue T., Lichtler A., Coffin J.D., Hurley M.M. Effect of over expressing fibroblast growth factor 2 protein isoforms in osteoblastic ROS 17/2.8 cells. J Cell Biochem (2003) 89:1291–1301.[CrossRef][Web of Science][Medline]
  16. Lee R.J., Springer M.L., Blanco-Bose W.E., Shaw R., Ursell P.C., Blau H.M. VEGF gene delivery to myocardium: deleterious effects of unregulated expression. Circulation (2000) 102:898–901.[Abstract/Free Full Text]
  17. Schwarz E.R., Speakman M.T., Patterson M., et al. Evaluation of intramyocardial injection of DNA expressing VEGF in MI model in rat angiogenesis or angioma formation. J Am Coll Cardiol (2000) 35:1323–1330.[Abstract/Free Full Text]
  18. Cao R., Brakenhielm E., Pawliuk R. Angiogenic synergism, vascular stability and improvement of hind-limb ischemia by a combination of PDGF-BB and FGF-2. Nat Med (2003) 9:604–613.[CrossRef][Web of Science][Medline]
  19. Kim I., Moon S.O., Park S.K., Chae S.W., Koh G.Y. Angiopoietin-1 reduces VEGF-stimulated leukocyte adhesion to the endothelial cells by reducing ICAM, VCAM, and E-selectin expression. Circ Res (2001) 89:477–479.[Abstract/Free Full Text]
  20. Chae J.K., Kim I., Lim S.T., et al. Co-administration of angiopoietin-1 and VEGF enhances collateral vascularization. Arterioscler Thromb Vasc Biol (2000) 20:2573–2578.[Abstract/Free Full Text]
  21. Ferrara N. VEGF and the regulation of angiogenesis. Recent Prog Horm Res (2000) 55:15–36.[Web of Science][Medline]
  22. Koh G.Y., Kim I., Kwak H.J., Yun M.J., Leem J.C. Biomedical significance of endothelial cell specific growth factor, angiopoietin. Exp Mol Med (2002) 34:1–11.[Web of Science][Medline]
  23. Thurston G., Suri C., Smith K., et al. Leakage resistant blood vessels in mice transgenically over expressing Ang-I. Science (1999) 286:2511–2514.[Abstract/Free Full Text]
  24. Yau T.M., Fung K., Weisel R.D., Fujii T., Mickle D.A., Li R.K. Enhanced myocardial angiogenesis by gene transfer with transplanted cells. Circulation (2001) 104:I218–I222.[Web of Science][Medline]
  25. Suzuki K., Murtuza B., Smolenski R.T., et al. Cell transplantation for the treatment of acute myocardial infarction using vascular endothelial growth factor-expressing skeletal myoblasts. Circulation (2001) 104:I207–I212.[Web of Science][Medline]
  26. Haider HKh., Ye L., Jiang S., et al. Angiomyogenesis for cardiac repair using human myoblasts as carriers of human vascular endothelial growth factor. J Mol Med (2004) 82:539–549.[Web of Science][Medline]
  27. Kay M.A., Glorioso J.C., Naldini L. Viral vectors for gene therapy: the art of turning infectious agents into vehicles for therapeutics. Nat Med (2001) 7:33–40.[CrossRef][Web of Science][Medline]
  28. Haider HKh., Jiang S.J., Ye L., Aziz S., Law P.K., Sim E.K.W. Effectiveness of transient immunosuppression using cyclosporine for xenomyoblast transplantation for cardiac repair. Transplant Proc (2004) 36:232–235.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Asian Cardiovasc. Thorac. Ann.Home page
E. K. Sim, L. Ye, and H. K. Haider
New Strategy for Cardiac Repair: Genetically Modified Skeletal Myoblasts
Asian Cardiovasc Thorac Ann, June 1, 2007; 15(3): 183 - 184.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ye, L.
Right arrow Articles by Sim, E. K.W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ye, L.
Right arrow Articles by Sim, E. K.W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?