Skip Navigation

European Journal of Heart Failure 2005 7(6):966-973; doi:10.1016/j.ejheart.2004.10.006
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by de Groote, P.
Right arrow Articles by Bauters, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by de Groote, P.
Right arrow Articles by Bauters, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2005 European Society of Cardiology

The impact of beta-adrenoreceptor gene polymorphisms on survival in patients with congestive heart failure{star}

Pascal de Grootea,*, Nicolas Lamblina,b, Nicole Helbecqueb, Frédéric Mouqueta, Eugène Mc Faddenc, Xavier Hermantb, Philippe Amouyelb, Jean Dallongevilleb and Christophe Bautersa,b

a Service de Cardiologie C, Hôpital Cardiologique, Centre Hospitalier Régional et Universitaire de Lille Boul Prof J Leclercq, 59037 Lille cedex, France
b INSERM U508, Institut Pasteur de Lille, 1 rue Calmette, 59019 Lille cedex, France
c Thoraxcenter, Erasmus Medical Centre Rotterdam, The Netherlands

* Corresponding author. Tel.: +33 3 20 44 50 45; fax: +33 3 20 44 48 81. E-mail address: pdegroote{at}chru-lille.fr


    Abstract
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
Objective: Discordant results have been published regarding a possible association between beta-adrenoreceptor (βAR) gene polymorphisms and survival in patients with congestive heart failure (CHF). The aim of the study was to analyze the impact of five functional βAR gene polymorphisms in patients with stable CHF.

Methods: We prospectively studied 444 consecutive patients with CHF related to left ventricular systolic dysfunction. The β1ARSer49Gly, β1ARGly389Arg, β2AR Arg16Gly, β2AR Gln27Glu and β2AR Thr164Ile polymorphisms were determined. Patients underwent echocardiography, radionuclide angiography and a cardiopulmonary exercise test.

Results: Mean age was 56.6±11.9 years old, left ventricular ejection fraction (LVEF) was 32±12%, and peak VO2 was 15.5±4.9 ml/min/kg or 63±18% of maximal predicted VO2. Most of the patients (95%) were receiving angiotensin converting enzyme inhibitors and 91% β-blockers. There was no statistically significant differences between baseline characteristics among β1AR and β2AR genotypes. During a median follow-up period of 1232 days, there were 110 cardiac-related deaths and five urgent transplantations. Independent predictors of survival were percent (%) of maximal predicted VO2 (p<0.0001), age (p<0.0001), LVEF (p=0.004), creatinine (p=0.02) and atrial fibrillation (p=0.04). No βAR polymorphisms were associated with survival. However, patients with the combined β2ARGly16Gly/β2ARGln27Gln genotype, who express receptors highly sensitive to down-regulation, had a significantly lower survival rate than patients with other genotypes but only in univariate analysis.

Conclusions: In this prospective study, we found no association between five functional βAR polymorphisms and survival in patients with stable CHF. However, we demonstrated, only in univariate analysis, a possible association between the combined β2ARGly16Gly/β2ARGln27Gln genotype and survival.

Key Words: Heart failure • Prognosis • Genetics • Receptors adrenergic beta

Received April 7, 2004; Revised July 8, 2004; Accepted October 14, 2004


    1. Introduction
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
Despite advances in the medical treatment of congestive heart failure (CHF) related to left ventricular systolic dysfunction, the mortality rate remains high [1–5]. To identify patients at high risk of cardiovascular events, risk stratification based on specific parameters has become an important part of management. New York Heart Association (NYHA) classification, peak oxygen consumption (VO2), plasma levels of B-type natriuretic peptide or left ventricular ejection fraction (LVEF) have been identified as powerful independent predictors of cardiac survival [6–10]. However, there is interindividual variability in the prognosis of CHF, with some patients having major cardiac events despite clinical stability, moderate left ventricular dysfunction and preserved exercise capacity. Conversely, other patients classified as severe on clinical evaluation have an unexpectedly prolonged survival. One emerging concept in cardiovascular diseases, which could explain this discrepancy, is the possible interaction between genetic polymorphisms and progression of the disease. Several studies have focused, with conflicting results, on the possible effect of angiotensin converting enzyme gene polymorphisms on survival in CHF patients [11,12]. Recently, conflicting results have been reported regarding the impact of β-adrenergic receptor polymorphisms on survival in CHF patients; while Börjesson et al. and Ligget et al. [13,14] suggested that the β1ARSer49Gly and the β2ARThr164Ile polymorphisms may be associated with clinical outcome, White et al. [15] found no impact of the β1ARGly389Arg polymorphism in a substudy of the MERIT-HF trial.

We conducted a prospective study in a group of consecutive CHF patients treated with ACE-inhibitors and β-blockers to analyze possible associations between genetic polymorphisms and prognosis. We report here the analysis concerning two polymorphisms in the β1AR gene (β1ARSer49Gly and β1ARGly389Arg) and three in the β2AR gene (β2ARGly16Arg, β2ARGln27Glu and β2ARThr164Ile). The rationale of this study is based on the evidence that these five polymorphisms have functional consequences, affecting either receptor down-regulation (β1ARSer49Gly, β2ARGly16Arg and β2ARGln27Glu) [16–19] or receptor G-protein coupling (β1ARGly389Arg and β2ARThr164Ile) [20–22].


    2. Methods
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
2.1. Study population
We included 444 unrelated consecutive Caucasian patients who were referred to our department between January 1998 and December 2001 for the evaluation of left ventricular systolic dysfunction. Patients were included if they were ambulatory, stable for at least 2 months and had a LVEF≤45%. Patients were excluded if they had a myocardial infarction, an episode of unstable angina or had undergone coronary revascularization in the previous 3 months. The coronary status of our patients was determined by systematic cardiac catheterization. Nine patients refused coronary angiography and were classified as having an unknown etiology. As part of prognostic evaluation, patients underwent echocardiography, radionuclide angiography and a cardiopulmonary exercise test, as previously described [9]. At the time of entry into the study, peripheral blood was drawn to determine beta-adrenoreceptor (βAR) types 1 and 2 genotypes.

The study was approved by the ethics committee of our institution, and written informed consent was obtained from all patients before inclusion.

2.2. Genetic analysis
Venous blood sampling was performed at the time of the initial evaluation. Genomic DNA was extracted from white blood cells by a «salting out» procedure, as previously described [23]. The βAR fragments containing sequences of interest were amplified by polymerase chain reaction (PCR), using protocols previously described. The sense and antisense primers were for the β1AR gene: codon 49 (nucleotide 145): 5'CCGGGCTTCTGGGGTGTTCC3' and 5'GGCGAGGTGATGGCGAGGTAGC3'; codon 389 (nucleotide 1165): 5'CGCTCTGCTGGCTGCCCTTCTTCC3' and 5'TGGGCTTCGAGTTCACCTGCTATC3'; for the β2AR gene: codon 16 (nucleotide 46): 5'CTTCTTGCTGGCACGCAAT3' and 5'CCAGTGAAGTGATGAAGTAGTTGG3'; codon 27 (nucleotide 79): 5'GGCCCATGACCAGATCAGCA3' and 5'GAATGAGGCTTCCAGGCGTC3'; codon 164 (nucleotide 491): 5'GGACTTTTGGCAACTTCTGG3' and 5'ACGAAGACCATGATCACCAG3'. The PCR conditions were, initial denaturation step at 94 °C for 5 min, followed by 30 cycles (denaturation at 94 °C for 30 s, annealing at various temperatures according to the amplified fragment [61°C for β1AR codon 49; 58 °C for β1AR codon 389; 56 °C for β2AR codons 16 and 27; and 55 °C for β2AR codon 164], extension at 72 °C for 30s) and a final extension step at 72 °C for 10 min. The β1AR gene codons 49 and 389 [24] and β2AR gene codon 164 [25] polymorphisms were detected using restriction enzyme digestion assays. Briefly, the 564 bp fragment obtained by PCR containing the β1AR codon 49 mutation was digested by Eco 0109 I, giving fragments of 345 and 219 bp for Gly49. The 530 bp product containing the β1AR codon 389 mutation was digested by Bcg I, giving fragments of 34, 342 and 154 bp for Arg389. The 358 bp fragment containing the β2AR codon 164 mutation was digested by Mnl I, giving fragments of 38, 114 and 206 bp for Thr 164 and 38 and 320 bp for Ile164. The β2AR gene codons 16 and 27 polymorphisms were detected using the allele specific hybridization method (ASO) [26]. The corresponding PCR product was 199 bp long. The Gly16Arg polymorphism was detected using the following primers: 5'CATGGCTTCCATTGCGTGCC3' for the Gly16 allele and 5'CATGGCTTCTATTGCGTGCC3' for the Arg16 allele (polymorphism underlined). Membranes were hybridised at 58 °C for 1 h, washed twice in 1xSSC, 10%SDS buffer for 5 min, washed in 0.5xSSC, 10% SDS buffer for 5 min and washed in 0.5xSSC, 10% SDS buffer at 62 °C for 3 min. The Gln27Glu polymorphism was detected using the following primers: 5'CGTCCCTTTGCTGCGTGACG3' for the Gln27 allele and 5'CGTCCCTTTCCTGCGTGACG3' for the Glu27 allele. Membranes were hybridised at 61 °C for 1 h, washed twice in 1xSSC, 10% SDS buffer for 5 min, washed in 0.5xSSC, 10% SDS buffer for 5 min and washed in 0.5xSSC, 10% SDS buffer at 65 °C for 3 min for the Gln27 membrane or 63 °C for the Glu27 membrane.

2.3. Follow-up
Clinical follow-up was performed at outpatient visits or by contact with the general practitioner or the referring cardiologist. The primary endpoint of the study was cardiac mortality defined as cardiac related death or urgent cardiac transplantation (United Network for Organ Sharing status 1). The secondary end-point was cardiac events defined as cardiac related death and all cardiac transplantations.

2.4. Statistical analysis
Statistical analyses were performed using SPSS software, version 9 (Chicago, IL). Mean values±S.D. were calculated for quantitative data. The quantitative variables were compared between groups using ANOVA or a Student t test. Qualitative variables were compared using the {chi}2 test. Differences in baseline characteristics among genotypes were tested with the general linear model procedure. Haplotypes were inferred to patients using two different algorithms (EM and SSD) [27,28], implemented in the GENOCOUNTING and PHASE softwares, respectively [28,29]. A Kaplan–Meier method was performed to estimate the cumulative survival; differences between subgroups were tested with a log rank test. A stepwise multivariate Cox proportional hazards analysis was performed to determine independent predictors of survival. Variables included in the multivariate analysis were the different βAR gene polymorphisms and variables with a p level <0.1 in the univariate analysis. Values of p<0.05 were considered significant.


    3. Results
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
3.1. Clinical characteristics and genotypes
Table 1 shows the baseline characteristics of the study population. Of the 444 patients, there were 79 women, 173 (39%) had a history of hypertension; 248 (56%) a history of hypercholesterolemia, and 134 (30%) had diabetes mellitus; atrial fibrillation was present in 49 patients (11%). At entry into the study, most of the patients were receiving angiotensin converting enzyme inhibitors (93%), 6% angiotensin type 1 receptor blockers and 44% β-blockers. However, at discharge, all the patients were started on β-blockers. During the follow-up, 91% of the patients were taking β-blockers and 95% angiotensin converting enzyme inhibitors. Other treatments were diuretics in 78%, spironolactone in 23% and digoxin in 43%. Twenty-seven patients had implantable defibrillators of which 10 were implanted during the follow-up period.


View this table:
[in this window]
[in a new window]

 
Table 1 Baseline characteristics of the study population and of the survivors and the patients who had a cardiac-related death

 
The distributions of the β1ARGly389Arg, β1ARSer49Gly, β2ARArg16Gly, β2ARGln27Glu and β2ARThr164Ile polymorphisms are shown in Tables 2 and 3. All allele distributions were in Hardy–Weinberg equilibrium. There was no statistically significant differences between baseline characteristics among β1AR and β2AR genotypes.


View this table:
[in this window]
[in a new window]

 
Table 2 Genotype frequencies and clinical characteristics of the population according to β1ARSer49Gly and β1ARGly389Arg polymorphisms

 


View this table:
[in this window]
[in a new window]

 
Table 3 Genotype frequencies and clinical characteristics according to β2ARGly16Arg, β2ARGln27Glu and β2ARThr164Ile polymorphisms

 
3.2. Survival analysis
During a median follow-up period of 1232 days, there were 110 cardiac-related deaths, 22 transplantations of which five were urgent and 18 deaths from noncardiac causes. One patient was lost to follow-up. The causes of the cardiac-related deaths were pump failure in 42 patients, sudden death in 45, myocardial infarction in 12 and other vascular death in 11. Differences in clinical characteristics between survivors and nonsurvivors (cardiac death and urgent transplantation) are presented in Table 1. As expected, there were some significant differences; nonsurvivors were older, more likely to have an ischemic cardiomyopathy, with a more depressed LVEF and lower exercise capacity.

Fig. 1 shows the different survival curves according to the β1AR genotypes of the patients. Fig. 2 shows survival curves according to the β2AR genotypes. There was no evidence of any significant impact of different βAR polymorphisms on survival. For some genotypes, combinations of some rare homozygous patients to heterozygote patients did not modify the results. Independent predictors of cardiac survival were peak VO2 (RR=0.95 [0.94–0.97], p<0.0001), age (RR=1.05 [1.03–1.06], p<0.0001), LVEF (RR=0.97 [0.95–0.99], p=0.003), creatinine (RR=1.08 [1–1.14], p=0.02) and atrial fibrillation (RR=1.72 [1.03–2.87], p=0.04). There was no impact of the different polymorphisms on the different causes of cardiac-related deaths.


Figure 1
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Kaplan–Meier survival curves for cardiovascular mortality as a function of β1AR gene polymorphisms. (A) Survival curves according to the β1ARSer49Gly polymorphism. (B) Survival curves according to the β1ARGly389Arg polymorphism.

 


Figure 2
View larger version (7K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Kaplan–Meier survival curves for cardiovascular mortality as a function of β2AR gene polymorphisms. (A) Survival curves according to the β2ARGly16Arg polymorphism. (B) Survival curves according to the β2ARGln27Glu polymorphism. (C) Survival curves according to the β2ARThr164Ile polymorphism.

 
3.3. Haplotypes analysis
A linkage disequilibrium exists between polymorphisms at position 49 and 389 of the β1AR gene and between polymorphisms at position 16 and 27 of the β2AR gene. Haplotypes were inferred for each patient providing a diploid combination. The two different algorithms (EM and SSD) gave similar results. Inferred haplotypes were in Hardy–Weinberg equilibrium (data not shown). Genetic combinations of the β1AR gene did not affect survival (data not shown). For the β2AR gene, one haplotype (β2ARGly16Gly/Gln27Gln) was associated with a lower survival rate but only in univariate analysis (p=0.05). We performed a statistical analysis in subgroups of patients with homozygous combinations at loci 16 and 27. We excluded all the heterozygous combinations to avoid a possible intermediate effect of these combinations. There were only three homozygous combinations in our study population (β2ARGly16Gly/Gln27Gln, β2ARGly16Gly/Glu27Glu and β2ARArg16Arg/Gln27Gln). There was no significant difference in baseline characteristics in the three subgroups of patients (Table 4). In univariate analysis, there was a significant difference in survival (Fig. 3). Survival rates at 1 year were 73%, 91% and 91% for β2ARGly16Gly/Gln27Gln, β2ARGly16Gly/Glu27Glu and β2ARArg16Arg/Gln27Gln, respectively. However, in multivariate analysis, the combined β2ARGly16Gly/Gln27Gln genotype was not an independent predictor of survival.


View this table:
[in this window]
[in a new window]

 
Table 4 Clinical characteristics of patients with homozygous combination at loci 16 and 27 of the β2AR gene

 


Figure 3
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Kaplan–Meier survival curves for cardiovascular mortality in patients with homozygous combinations at loci 16 and at loci 27 for the β2AR gene.

 
3.4. Power of the study
A negative study should be interpreted in view of its statistical power. For the β1AR polymorphisms, our study was powered (beta risk=0.2) to detect a 10% difference in the survival rate of patients with the wild genotype and those with the mutated carriers. For the β2ARArg16Gly and β2ARGln27Glu polymorphisms, our study was powered to detect a 15% difference in the survival rate of patients with homozygous genotypes. For the β2ARThr164Ile polymorphism, the number of patients required to detect a 10% difference in the survival rate between subgroups is at least 1730 patients, and thus, our study was underpowered regarding this polymorphism.


    4. Discussion
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
In the present study, we found no major impact of five functional βAR polymorphisms on survival. Three previous studies have analyzed the impact of a βAR polymorphism on survival in CHF.

Börjesson et al. [13] described, in 261 patients with idiopathic-dilated cardiomyopathy, an association between the β1ARSer49Gly polymorphism and survival. In this study, the mutation was protective, and homozygous β1ARSer49 patients had a 2.5-fold increase in the risk of dying compared to Gly variants. By contrast, in our study population, the survival curves clearly demonstrated the lack of association between this polymorphism and outcome. Although patients with the rare β1ARGly49Gly genotype did not have any event during our follow-up period, heterozygous patients had the same survival as homozygous β1ARSer49 patients. Including the seven homozygous β1ARGly49 patients in the heterozygous subgroup did not change the results. There are several possible explanations for these conflicting results. Our study was prospective, including consecutive patients with a LVEF≤45%. In Börjesson et al.'s study, selection of patients was based on clinical parameters, and patients with diastolic dysfunction were eligible for inclusion, explaining why their mean LVEF was close to 45%. In addition, only 25% of their patients were treated with ACE-I and 39% with β-blockers, while in our study, most of the patients received the combination of ACE-I and β-blockers.

White et al. [15], in a substudy of the MERIT-HF trial in 600 patients, demonstrated that the β1ARGly389Arg polymorphism was not associated with survival. We found a similar result, and as in White et al.'s study, we found no association between this polymorphism and baseline characteristics. Most of our patients were receiving β-blockers, while 307 patients received metoprolol CR/XR in the substudy of the MERIT-HF trial. White et al. clearly demonstrated that this polymorphism did not influence cardiac responses induced by the β-blocker nor its survival benefit. Other studies have demonstrated, in hypertensive subjects, no association between the β1ARGly389Arg polymorphism and the response to β-blocker [30].

The third βAR gene polymorphism linked to survival in CHF patients is the β2ARThr164Ile polymorphism. Liggett et al. [14] were the first to suggest a possible association between this polymorphism of the βAR gene and survival. They demonstrated in 259 patients that β2ARThr164Ile variants had a lower survival rate compared to homozygous β2ARThr164Thr, with an adjusted relative risk of 4.81 (p< 0.001). Several experimental studies have demonstrated that this polymorphism affected the βAR-G-protein coupling, heterozygous receptors having reduced basal and agonist stimulated activity [21,22,31]. Thus, β2AR164Ile variants are genetically β-blocked. However, these conclusions were based on only 10 heterozygous patients. Unfortunately, this mutation is rare, affecting less than 4% of the population, and no homozygous subjects for the mutation have been discovered. In the present study, we did not demonstrate any association between this polymorphism and survival. Because we had only 16 heterozygous patients, this negative result is difficult to interpret. A study powered to detect a difference in survival rate of at least 10% will require more than 1730 patients. Whatever the effect of this polymorphism on survival, its impact on clinical management of patients with CHF is likely to be limited. In the same study, Liggett at al. [14] analyzed the association between the β2ARArg16Gly and the β2ARGln27Glu polymorphisms and survival. They did not find any influence of these polymorphisms on survival. We have confirmed these results but in a larger number of patients, most of whom were receiving β-blockers (24% in the study by Liggett et al.).

Both the β1ARSer49Gly and the β1ARGly389Arg polymorphisms and the β2ARGly16Arg and the β2ARGln27Glu are in linkage disequilibrium. Thus, some genetic combinations occur more frequently, and it is interesting to analyze these different genetic combinations. We did not find any effect of the genetic combination between polymorphisms at loci 49 and 389 of the β1AR. However, we demonstrated an impact on survival of a genetic combination of the β2AR, the combined β2ARGly16Gly/β2ARGln27Gln genotype, but only in univariate analysis. In the study by Liggett et al. [14], although survival rates were lower in patients with β2ARGly16Gly genotype and in patients with the β2ARGln27Gln genotype compared to patients with other genotypes, they did not find any impact of this genetic combination on survival. This discordant result could be related to the low number of patients harboring this haplotype. The functional consequences of these two polymorphisms affecting receptor down-regulation have been demonstrated in vitro. However, recent in vivo studies have demonstrated that the level of β2AR down-regulation was similar whatever the genotype at position 16 and 27, but this down-regulation was slower in homozygous β2ARGlu27Glu subjects than in other subjects [32,33]. Because of the chronic adrenergic stimulation in CHF patients, it is possible that the level of β2AR down-regulation is similar in all the patients, independently of genotypes. This finding could also explain the discordant results in survival studies. We have to keep in mind that our positive result was only found in univariate analysis, and after adjustment with well-known prognostic parameters, the combined β2ARGly16Gly/Gln27Gln genotype was not an independent predictor of survival.

4.1. Study limitations
The number of patients included in the present study is limited, and it was therefore difficult to draw conclusions for some subgroups of patients with specific genotypes. However, we had a long median duration of follow-up (longer than 3 years) with 115 cardiac-related deaths. The strengths of this study also include a prospective design with a systematic prognostic evaluation at baseline, which allowed us to perform multivariate analyses.


    5. Conclusions
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
In conclusion, we found no impact of five functional βAR polymorphisms on survival in patients with stable CHF. There was a possible association between the combined β2ARGly16Gly/β2ARGln27Gln genotype and survival. Further studies are required to confirm this result.


    Notes
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
{star} No author has any conflict of interest. Back


    References
 Top
 Notes
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 

  1. The SOLVD Investigators. Effect of enalapril on survival in patients with reduced left ventricular ejection fractions and congestive heart failure. The SOLVD investigators. N. Engl. J. Med. (1991) 325:293–302.[Abstract]
  2. Pitt B., Zannad F., Remme W.J., Cody R., Castaigne A., Perez A., et al. The effect of spironolactone on morbidity and mortality in patients with severe heart failure. N. Engl. J. Med. (1999) 341:709–717.[Abstract/Free Full Text]
  3. CIBIS-II investigators and committees. The cardiac insufficiency bisoprolol study: II (CIBIS-II). A randomised trial. Lancet (1999) 353:9–13.[CrossRef][Web of Science][Medline]
  4. MERIT-HF study group. Effect of metoprolol CR/XL in chronic heart failure: metoprolol CR/XL randomised intervention trial in congestive heart failure (MERIT-HF). Lancet (1999) 353:2001–2007.[CrossRef][Web of Science][Medline]
  5. Packer M., Coats A.J., Fowler M.B., Katus H.A., Krum H., Mohacsi P., et al. Effect of carvedilol on survival in severe chronic heart failure. N. Engl. J. Med. (2001) 344:1651–1658.[Abstract/Free Full Text]
  6. Cohn J.N., Johnson G.R., Shabetai R., Loeb H., Tristani F., Rector T., et al. Ejection fraction, peak exercise oxygen consumption, cardiothoracic ratio, ventricular arrhythmias, and plasma norepinephrine as determinants of prognosis in heart failure. The V-HeFT VA cooperative studies group. Circulation (1993) 87:VI5–VI6.[Medline]
  7. Mancini D.M., Eisen H., Kussmaul W., Mull R., Edmunds L.H. Jr., Wilson J.R. Value of peak exercise oxygen consumption for optimal timing of cardiac transplantation in ambulatory patients with heart failure. Circulation (1991) 83:778–786.[Abstract/Free Full Text]
  8. Stelken A.M., Younis L.T., Jennison S.H., Miller D.D., Miller L.W., Shaw L.J., et al. Prognostic value of cardiopulmonary exercise testing using percent achieved of predicted peak oxygen uptake for patients with ischemic and dilated cardiomyopathy. J. Am. Coll. Cardiol. (1996) 27:345–352.[Abstract]
  9. de Groote P., Millaire A., Foucher-Hossein C., Nugue O., Marchandise X., Ducloux G., et al. Right ventricular ejection fraction is an independent predictor of survival in patients with moderate heart failure. J. Am. Coll. Cardiol. (1998) 32:948–954.[Abstract/Free Full Text]
  10. de Groote P., Dagorn J., Soudan B., Lamblin N., Mc Fadden E., Bauters C. B-type natriuretic peptide and peak exercise oxygen consumption provide independent information for risk stratification in patients with stable congestive heart failure. J. Am. Coll. Cardiol. (2004) 43:1584–1589.[Abstract/Free Full Text]
  11. Andersson B., Sylven C. The DD genotype of the angiotensin-converting enzyme gene is associated with increased mortality in idiopathic heart failure. J. Am. Coll. Cardiol. (1996) 28:162–167.[Abstract]
  12. Vancura V., Hubacek J., Malek I., Gebauerova M., Pitha J., Dorazilova Z., et al. Does angiotensin-converting enzyme polymorphism influence the clinical manifestation and progression of heart failure in patients with dilated cardiomyopathy? Am. J. Cardiol. (1999) 83:461–462.[CrossRef][Web of Science][Medline]
  13. Börjesson M., Magnusson Y., Hjalmarson A., Andersson B. A novel polymorphism in the gene coding for the beta(1)-adrenergic receptor associated with survival in patients with heart failure. Eur. Heart J. (2000) 21:1853–1858.[Abstract/Free Full Text]
  14. Liggett S.B., Wagoner L.E., Craft L.L., Hornung R.W., Hoit B.D., McIntosh T.C., et al. The Ile164 beta2-adrenergic receptor polymorphism adversely affects the outcome of congestive heart failure. J. Clin. Invest. (1998) 102:1534–1539.[Web of Science][Medline]
  15. White H.L., de Boer R.A., et alOn behalf of the MERIT-HF Study Group. An evaluation of the beta-1 adrenergic receptor Arg389Gly polymorphism in individuals with heart failure: a MERIT-HF substudy. Eur. J. Heart Fail. (2003) 5:463–468.[CrossRef][Web of Science][Medline]
  16. Rathz D.A., Brown K.M., Kramer L.A., Ligett S.B. Amino acid 49 polymorphisms of the human beta 1-adrenergic receptor affect agonist-promoted trafficking. J. Cardiovasc. Pharmacol. (2002) 39:155–160.[CrossRef][Web of Science][Medline]
  17. Green S., Turki J., Innis M., Ligett S.B. Amino-terminal polymorphisms of the β2-adrenergic receptor impart distinct agonist-promoted regulatory properties. Biochemistry (1994) 33:9414–9419.[CrossRef][Web of Science][Medline]
  18. Levin M.C., Marullo S., Muntaner O., Andersson B., Magnusson Y. The myocardium-protective Gly-49 variant of the β1-adrenergic receptor exhibits constitutive activity and increased desensitization and down-regulation. J. Biol. Chem. (2002) 277:30429–30435.[Abstract/Free Full Text]
  19. Dishy V., Sofowora G.G., Xie H.G., Kim R.B., Byrne D.W., Stein M., et al. The effect of common polymorphisms of the β2-adrenergic receptor on agonist-mediated vascular desensitization. N. Engl. J. Med. (2001) 345:1030–1035.[Abstract/Free Full Text]
  20. Mason D.A., Moore J.D., Green S.A., Liggett S.B. A gain-of-function polymorphism in a G-protein coupling domain of the human beta1-adrenergic receptor. J. Biol. Chem. (1999) 274:12670–12674.[Abstract/Free Full Text]
  21. Green S.A., Cole G., Jacinto M., Innis M., Liggett S.B. A polymorphism of the human beta 2-adrenergic receptor within the fourth transmembrane domain alters ligand binding and functional properties of the receptor. J. Biol. Chem. (1993) 268:23116–23121.[Abstract/Free Full Text]
  22. Turki J., Lorenz J.N., Green S.A., Donnelly E.T., Jacinto M., Liggett S.B. Myocardial signaling defects and impaired cardiac function of a human beta 2-adrenergic receptor polymorphism expressed in transgenic mice. Proc. Natl. Acad. Sci. U. S. A. (1996) 93:10483–10488.[Abstract/Free Full Text]
  23. Miller S.A., Dykes D.D., Polesky H.F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. (1988) 16:1215.[Free Full Text]
  24. Maqbool A., Hall A.S., Ball S.G., Balmforth A.J. Common polymorphisms of beta1-adrenoceptor: identification and rapid screening assay. Lancet (1999) 353:897.[Web of Science][Medline]
  25. Large V., Hellstrom L., Reynisdottir S., Lonnqvist F., Eriksson P., Lannfelt L., et al. Human beta-2 adrenoceptor gene polymorphisms are highly frequent in obesity and associate with altered adipocyte beta-2 adrenoceptor function. J. Clin. Invest. (1997) 100:3005–3013.[Web of Science][Medline]
  26. Meirhaeghe A., Helbecque N., Cottel D., Amouyel P. Impact of polymorphisms of the human beta2-adrenoceptor gene on obesity in a French population. Int. J. Obes. Relat. Metab. Disord. (2000) 24:382–387.[CrossRef][Web of Science][Medline]
  27. Excoffier L., Slatkin M. Maximum-likelihood estimation of molecular haplotype frequencies in a diploid population. Mol. Biol. Evol. (1995) 12:921–927.[Abstract]
  28. Stephens M., Smith N.J., Donnelly P. A new statistical method for haplotype reconstruction from population data. Am. J. Hum. Genet. (2001) 68:978–989.[CrossRef][Web of Science][Medline]
  29. Zhao J.H., Lissarrague S., Essioux L., Sham P.C. GENOCOUNTING: haplotype analysis with missing genotypes. Bioinformatics (2002) 18:1694–1695.[Abstract/Free Full Text]
  30. O'Shaughnessy K.M., Fu B., Dickerson C., Thurston D., Brown M.J. The gain-of-function G389R variant of the β1-adrenoceptor does not influence blood pressure or heart rate response to b-blockade in hypertensive subjects. Clin. Sci. (2000) 99:233–238.[CrossRef][Web of Science][Medline]
  31. Brodde O.E., Büscher R., Tellkamp R., Radke J., Dhein S., Insel P.A. Blunted cardiac responses to receptor activation in subjects withThr164Ile β2-adrenoceptors. Circulation (2001) 103:1048–1050.[Abstract/Free Full Text]
  32. Bruck H., Leineweber K., Beilfub A., Weber M., Heusch G., Philipp T., et al. Genotype-dependent time course of lymphocyte β2-adrenergic receptor down-regulation. Clin. Pharmacol. Ther. (2002) 74:255–263.[CrossRef][Web of Science]
  33. Bruck H., Leineweber K., Büscher R., Ulrich A., Radke J., Insel P.A., et al. The Gln27GLU β2-adrenoceptor polymorphism slows the onset of desensitization of cardiac functional response in vivo. Pharmacogenetics (2002) 13:59–66.[CrossRef][Web of Science]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
G. W. Dorn II and S. B. Liggett
Mechanisms of Pharmacogenomic Effects of Genetic Variation within the Cardiac Adrenergic Network in Heart Failure
Mol. Pharmacol., September 1, 2009; 76(3): 466 - 480.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
M. C. Michel and R. Buscher
Beta2-Adrenergic Receptor Gene Polymorphisms: Will the Important One Please Step Forward?
J. Am. Coll. Cardiol., October 21, 2008; 52(17): 1389 - 1390.
[Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. J. Sehnert, S. E. Daniels, M. Elashoff, J. A. Wingrove, C. R. Burrow, B. Horne, J. B. Muhlestein, M. Donahue, S. B. Liggett, J. L. Anderson, et al.
Lack of Association Between Adrenergic Receptor Genotypes and Survival in Heart Failure Patients Treated With Carvedilol or Metoprolol
J. Am. Coll. Cardiol., August 19, 2008; 52(8): 644 - 651.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
A. Muthumala, F. Drenos, P. M. Elliott, and S. E. Humphries
Role of {beta} adrenergic receptor polymorphisms in heart failure: Systematic review and meta-analysis
Eur J Heart Fail, January 1, 2008; 10(1): 3 - 13.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by de Groote, P.
Right arrow Articles by Bauters, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by de Groote, P.
Right arrow Articles by Bauters, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?