© 2003 European Society of Cardiology
Suppression of cytokines and nitric oxide production, and protection against lethal endotoxemia and viral myocarditis by a new NF-
B inhibitor
a Department of Cardiovascular Medicine Kyoto University Graduate School of Medicine, 54 Kawahara-cho Shogoin, Sakyo-ku, Kyoto 606-8397, Japan
b Suntory Biomedical Research Limited Japan
* Corresponding author. Present address: Daiichi-Suntory Biomedical Research Limited, Osaka, 618-8513, Japan. Tel.: +81-75-751-3186; fax: +81-75-751-6477. E-mail address: amat{at}kuhp.kyoto-u.ac.jp
| Abstract |
|---|
|
|
|---|
Background: Nuclear factor kappa B (NF-
B) is activated by several factors, which increase the inflammatory response, and this activation, in turn, leads to the expression of several genes such as cytokines, and may play an important role in cardiovascular diseases.
Aims: The aim of the study is to examine the effect of SUN C8079, a newly synthesized NF-
B inhibitor in vitro and in vivo.
Methods: We examined the effects of SUN C8079 on the transcriptional responses of NF-
B, on activation of NF-
B in electrophoretic mobility shift assay, and on the gene expressions of tumor necrosis factor (TNF)-
and iNOS. We also studied effects of SUN C8079 on lethal endotoxemia and viral myocarditis in mice.
Results: SUN C8079 inhibited the lipopolysaccharide (LPS)-induced expression of the genes of TNF-
and iNOS by inhibiting the activation of NF-
B in vitro. SUN C8079 inhibited the systemic release of TNF-
and improved mortality in LPS-treated mice. In addition to protecting mice against lethal endotoxemia, SUN C8079 prevented the development of myocarditis due to the encephalomyocarditis virus (EMCV), and inhibited the expressions of proinflammatory cytokines and the iNOS gene in cardiac tissues.
Conclusion: These findings suggest that the activation of NF-
B plays an important role in the pathogenesis of endotoxemia and viral myocarditis, and that the NF-
B inhibitor, SUN C8079, may be therapeutic in these disorders.
Key Words: Nuclear factor kappa B Tumor necrosis factor Cytokines Inducible nitric oxide synthase Endotoxemia Myocarditis
Received May 16, 2003; Revised July 28, 2003; Accepted October 8, 2003
| 1. Introduction |
|---|
|
|
|---|
Recent studies have clarified the roles played by several cytokines in various cardiovascular disorders [1], and have found increased levels of circulating TNF-
, interleukin (IL)-1β, IL-6 and other proinflammatory cytokines in patients with myocarditis, cardiomyopathy, heart failure and acute myocardial infarction [2,3].
There is increasing evidence that the inflammatory response is associated with an increase in transcription of inflammatory genes. Gene transcription is regulated by transcription factors that are sequence-specific DNA binding proteins capable of modulating the rate of transcription. One such transcription factor, NF-
B regulates the expression of a wide range of genes involved in immune and inflammatory responses. NF-
B belongs to a family of proteins, including p50, p52, RelA, c-Rel and RelB, which can form transcriptionally active or repressive homo- or heterodimers [4]. In its inactive state, an NF-
B dimer is present in the cytosol, where it is bound to an inhibitory protein such as I
B. We and others have reported that the expression of IL-1β, TNF-
, and iNOS is regulated at the transcriptional level and that one key factor in this process is NF-
B activation [5]. Inhibitors of NF-
B activation may, therefore, have broad therapeutic applications. Several inhibitors of NF-
B activation have recently been described, most of which are effective in cell-based experiments in vitro, though unsuitable for therapeutic applications since they cause unacceptable adverse effects [6]. This report describes a new NF-
B inhibitor, SUN C8079 which was discovered by random screening (Fig. 1) ([7], manuscript in preparation), which suppresses the expression of proinflammatory cytokines in vivo, offering a new approach in the treatment of viral myocarditis, endotoxemia and heart failure.
|
| 2. Methods |
|---|
|
|
|---|
2.1. Materials
Lipopolysaccharide (LPS, Escherichia coli strain 055:B5) and human IL-1β were purchased from Sigma (St Louis, MO, USA) and Genzyme (Boston, MA, USA). SUN C8079 and human TNF-
were obtained from our laboratory.
We examined whether SUN C8079 has an antioxidant effect since an antioxidant effect may inhibit activation of NF-
B. Superoxide scavenging activity of SUN C8079 was determined by a colorimetric method using WST-1 (2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-(2, 4-disulfophenyl)-2H- tetrazolium, monosodium salt, Dojindo, Japan), which produces a water-soluble formazan dye upon reduction with a superoxide anion [8]. No scavenging of superoxide anion from a xanthine–xanthine oxidase reaction by 50 µmol/l of SUN C8079 was observed.
2.2. Transcription assays
We measured responses of NF-
B in A549 cells, human adenocarcinoma cells (ATCC) under conditions of stable transfection with the NF-
B reporter plasmid (pNF
B-Luc, Stratagene, CA) [9], stimulated with human IL-1β (1 ng/ml) or human TNF-
(50 ng/ml) for 3 h with or without SUN C8079. SUN C8079 was prepared as 10 mg/ml in dimethylsulfoxide (DMSO) and added to the cells 1 h before each stimulation. The luciferase activity was determined 3 h after stimulation using the Luciferase Reporter Assay System (Promega, UK).
2.3. Measurement of TNF-
and NOx production
RAW264.7, murine macrophage cells (ATCC), were cultured in presence or absence of SUN C8079 for 60 min, followed by stimulation with 10 µg/ml of LPS for 4 h (for TNF-
production) or for 24 h (for NOx production). TNF-
levels were determined by Biotrack ELISA kit (Amersham, UK). NOx levels were determined by the Griess method [10].
2.4. Preparation of nuclear extracts and EMSA
RAW264.7 cells were cultured in the presence or absence of SUN C8079 for 60 min followed by stimulation with 10 µg/ml of LPS for 60 min. Cardiac fibroblasts prepared from the hearts of 14-day-old DBA2 fetal mice, as described previously [11], were cultured and infected with EMCV for 1–6 h. Then, the nuclear extracts isolated were incubated with rhodamine-labeled NF-
B probe and the assay was carried out according to the method previously described [12].
2.5. Total RNA extraction and cDNA synthesis
Total RNA was extracted from RAW264.7 cells or the heart tissue of mice (described below) using ISOGEN (Wako, Japan). The extracted RNA was then reverse transcribed to cDNA as described previously.
2.6. RT-PCR
cDNAs obtained above were amplified using TNF-
primers (forward: TTCTGTCTACTGAACTTCGGGGTGATCGGTCC, reverse: GTATGAGATAGCAAATCGGCTGACGGTGTGGG, 354 bp), iNOS primers (830 bp) [10] and GAPDH primers (forward: TGAAGGTCGGTGTGAACGGATTTGGC, reverse: CATGTAGGCCATGAGGTCCACCAC, 983 bp) and PCR products were electrophoresed on a 2.0% agarose gel.
2.7. Endotoxin lethality studies
Eight-week-old female BALB/c mice, weighing 18–20 g (Japan SLC Inc., Japan), were injected i.p. with 300 µg of LPS in a volume of 200 µl. SUN C8079, 0.3, 3 or 30 mg/kg was administered i.p. 1 h before the injection of LPS.
2.8. Viral infection in mice
Four-week-old inbred male DBA/2 mice were inoculated i.p. with 0.1 ml of the M (myocardiotropic) variant of EMCV diluted in PBS to a concentration of 10 plaque forming units/ml. The day of virus inoculation was defined as day 0 in all subsequent studies. SUN C8079 was administered in doses of 3 or 30 mg/kg daily for 14 days from the day of EMCV inoculation while control mice received the vehicle only. Each group consisted of 24 mice. EMSA was also performed using hearts with EMCV myocarditis on day 5 after EMCV inoculation [13].
2.9. Quantification of IL-1β, TNF-
and iNOS mRNA in the heart
SUN C8079 was administered in doses of 30 mg/kg daily for 5 days from the day of EMCV inoculation while control mice received the vehicle only. The hearts of surviving mice were homogenized and total RNA was extracted as described before. IL-1β, TNF-
and iNOS mRNA in the hearts was quantified by real-time quantitative PCR (TaqMan PCR). Real-time quantitative PCR was carried out with TaqMan Universal PCR Master Mix and an ABI prism 7700 sequence detector (Perkin–Elmer, UK) under the following conditions: 50 °C for 2 min, 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s, 60 °C for 1 min. TaqMan primer and probe sets for mouse IL-1β, mouse TNF-
, or mouse iNOS and the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were designed using Primer Express software (Perkin–Elmer). Primer and probe sequences (5'-3') (forward primer, reverse primer, TaqMan probe);
IL-1β:CAACCAACAAGTGATATTCTCCATG, GATCCACACTCTCCAGCTGCA, CTGTGTAATGAAAGACGGCACACCCACC; TNF-
:CATCTTCTCAAAATTCGAGTGACAA, TGGGAGTAGACAAGGTACAACCC, CACGTCGTAGCAAACCACCAAGTGGA; iNOS:CAGCTGGGCTGTACAAACCTT, CATTGGAAGTGAAGCGTTTCG, CGGGCAGCCTGTGAGACCTTTGA; GAPDH:TGCACCACCAACTGCTTAG, GGATGCAGGGATGATGTTC, CAGAAGACTGTGGATGGCCCCTC.
Additional reactions were performed on each 96-well plate using known dilutions of mouse genomic DNA as a PCR template to allow construction of a standard curve relating threshold cycle to template copy number.
2.10. Histological examinations
The hearts were fixed in 10% formalin, embedded in paraffin, sectioned and stained with hematoxylin and eosin. The extent of cellular infiltration and myocardial necrosis was graded by 2 observers blinded to the results of the experiments and scored as described previously [14].
2.11. Virus concentrations in the heart
Concentration of infectious virus in the heart from mice was measured as described previously [15].
2.12. Statistical analyses
Survival data were analyzed by Kaplan–Meier plots and survival differences between control and active treatments were tested by the mantel-Cox log rank test. Statistical comparisons of histological scores and levels of IL-1β, TNF-
and iNOS were performed by analysis of variance, followed by Fisher's protected least significance test for multiple samples comparisons. Values are expressed as mean±S.E. A P value <0.05 was considered statistically significant.
| 3. Results |
|---|
|
|
|---|
3.1. Effects of SUN C8079 in vitro
We first examined whether SUN C8079 inhibits transcriptional responses of NF-
B in A549 cells transfected with the NF-
B reporter plasmid-stimulated IL-1β or TNF-
. Compared with controls, SUN C8079 decreased significantly (P<0.001) and in a concentration-dependent fashion the expression of luciferase protein stimulated with (1) IL-1β, from 79.8±2.3% at 1 µmol/l, to 64.1±2.4% at 3 µmol/l, to 49.6±0.5% at 10 µmol/l, to 18±1.4% at 30 µmol/l and (2) TNF-
, from 71±0.6% at 1 µmol/l, 66±1% at 3 µmol/l, 48.2±0.1% at 10 µmol/l, and 17±0.9% at 30 µmol/l (Fig. 2a). SUN C8079, 30 µmol/l, did not inhibit the constitutive reporter activity expressed by SV40-driven reporter plasmid (pRL-SV, Promega) in A549 cells. Furthermore, the expression of the reporter gene under the control of the cyclic AMP responsive element (pCRE-Luc, Stratagene) increased 4.8-fold after dibutyryl cyclic AMP (dbcAMP) stimulation. SUN C8079 did not suppress the dbcAMP-mediated gene expression. Therefore, SUN C8079 is a specific inhibitor for the NF-
B activation.
|
In electrophoretic mobility shift assay (EMSA) SUN C8079 inhibited the activation of NF-
B in a murine macrophage line, RAW264.7 cells (Fig. 2b). To determine whether SUN C8079 inhibits the gene expressions of TNF-
and iNOS, RAW 264.7 cells were stimulated with LPS, mRNA was extracted, and the levels were quantified by reverse transcription polymerase chain reaction (PCR). The NF-
B inhibitor decreased the expressions of TNF-
and iNOS genes (Fig. 2c) stimulated with LPS. In addition, SUN C8079 suppressed the production of TNF-
from 5.7±0.4 ng/ml to 3.3±0.1 ng/ml at 10 µmol/l, to 0.6±0.1 ng/ml at 30 µmol/ml, and of nitric oxide (NO) from 55±5 nmol/ml to 28±0.7 nmol/ml at 10 µmol/ml, to 4.7±0.9 nmol/l at 30 µmol/ml (P<0.001, Fig. 2d).
3.2. Effects of SUN C8079 on lethal endotoxemia in mice
We studied the effects of SUN C8079 in a mouse model of endotoxemia by LPS injection, which induces a rapid increase in plasma concentrations of TNF-
within 1 h. This increase in TNF-
protein tended to be inhibited by SUN C8079, 100 mg/kg, administered immediately after injection of LPS (0.83±0.07 ng/ml in actively treated mice vs. 1.07±0.08 ng/ml in controls, Fig. 3a). In a dose of 400 µg per mouse, LPS caused death of all animals within 24 h (n=10). SUN C8079, 30 mg/kg, administered immediately after LPS reduced this mortality to 50% (each group, n=10 P<0.01). This protective effect of SUN C8079 was dose-dependent, and not observed with the lowest dose of 0.3 mg/kg (Fig. 3b). SUN C8079 inhibited the activation of NF-
B in the heart of mice with EMCV myocarditis as shown in EMSA (Fig. 3c).
|
SUN C8079, 30 mg/kg/day was administered for 5 days in normal mice. No abnormality was found in alanine aminotransferase, aspartate aminotransferase or blood urea nitrogen in these mice. SUN C8079, up to 100 mg/kg, had no lethal effect in normal mice (n=5).
3.3. Effects of SUN C8079 on viral myocarditis in mice
To determine the effects of SUN C8079 on virus-induced NF-
B activation, we carried out EMSA using non-cardiomyocytes prepared from the hearts of DBA/2 fetal mice. Infection with the EMCV induced activation of NF-
B in cultured cardiac fibroblasts (Fig. 4a) but activation of NF-
B was not apparent in cardiomyocytes upon inoculation with EMCV (data not shown).
|
We next investigated the effect of SUN C8079 on the survival of mice infected with EMCV. Survival after 14 days of treatment with SUN C8079, 3 and 30 mg/kg was 46% and 75%, respectively, vs. 46% in the control group. This difference in survival of mice treated with SUN C8079 30 mg/kg vs. the control group was statistically significant (P<0.05, Fig. 4b). The mean histological score for myocardial necrosis was 2.8±0.2 (n=10) in the control group vs. 1.9±0.3 (n=12) in mice treated with SUN C8079, 30 mg/kg. The mean myocardial necrosis grade was significantly lower in the group treated with SUN C8079, 30 mg/kg, than in the control group (P<0.05, Fig. 4c,d). The mean scores for cellular infiltration in the control and high-dose treatment groups were 2.8±0.2 and 1.9±0.3, respectively (P<0.05, Fig. 4d). From our previous observations in this animal model, a peak in the expression of cytokine mRNA in the heart occurs 5–7 days after EMCV inoculation [16]. Therefore, we measured the effects of SUN C8079 on cytokine and iNOS mRNA levels on day 5. The levels in the hearts were measured by real-time quantitative PCR method. In the mice treated with SUN C8079, TNF-
IL-1β, and iNOS mRNA levels were significantly decreased (TNF-
, 0.32-fold, P<0.05; IL-1β, 0.24-fold, P<0.05; iNOS, 0.29-fold, P<0.05; Fig. 4e). Myocardial viral concentrations were measured in the hearts of mice 5 days after EMCV inoculation. The mean myocardial viral concentration in controls was 129±97 pfu/mg (n=5) vs. 92±31 pfu/mg in the SUN C8079-treated group, indicating no significant effect of SUN C8079 on viral replication.
| 4. Discussion |
|---|
|
|
|---|
Inflammation and cytokines are increasingly recognized as important factors in the pathogenesis and pathophysiology of heart failure and other cardiac disorders. High levels of circulating cytokines, which depress myocardial contractility in vitro and in vivo, have been reported in patients with heart failure [1–3]. There is increasing evidence that the inflammatory response and production of cytokines are associated with activation of NF-
B.
NF-
B is activated by several factors, which increase the inflammatory response, including viral infections, oxidants and antigens. This activation, in turn, leads to the coordinated expression of several protein-encoding genes such as cytokines, chemokines, adhesion molecules and enzymes involved in mediator synthesis, and the further amplification and perpetuation of the inflammatory response. NF-
B is therefore an obvious target for new types of antiinflammatory treatment.
In endotoxemia, the acute and overwhelming activation of NF-
B can cause widespread endothelial cell death with disturbances in membrane permeability and disseminated coagulation [17]. However, it has become apparent that NF-
B can also protect cells against death. TNF-
can cause programmed cell death (apoptosis), which is often accompanied by increased activation of NF-
B. However, inhibition of NF-
B increased rather than reduced rates of cell death in some experiments [18]. In addition, NF-
B is activated during ischemic preconditioning, and its pharmacological inhibition of NF-
B lowered cardioprotection in animal models [19]. It is apparent that the role of NF-
B in the regulation of cell viability is multidimensional and much additional work is needed to fully clarify these mechanisms [20].
Glucocorticoids are effective inhibitors of NF-
B, though produce endocrine and metabolic adverse effects when prescribed systemically, which may not be caused by a more specific NF-
B inhibitor. Aspirin and sodium salicylate also inhibit the activation of NF-
B, albeit only in relatively high concentrations [21], and gold salts inhibit the binding of NF-
B to DNA [22], which suggests that the antiinflammatory properties of these drugs may be, at least in part, mediated by the inhibition of NF-
B. Inhibition of NF-
B activation and protection from LPS shock by pyrrolidine dithiocarbamate (PDTC) [23,24], has been reported though PDTC has been found to be toxic [6]. We have previously reported that circulating TNF-
levels are increased in mice infected with EMCV, and that pre-treatment with an anti-TNF-
antibody attenuated myocardial injury and decreased mortality in the acute stage [25]. In addition, our laboratory has recently reported that in the same model, the intracardiac expression of cytokine genes was increased. The degree of their expression correlated with the severity of disease evolution [16]. A recent study on EMCV myocarditis in TNF-
knockout mice showed a higher survival [26]. Since knockout mice lack TNF-
during development, they may have a different response against viral infection, than that associated with specific neutralization of TNF-
immediately after viral infection.
In our murine model of heart failure due to viral myocarditis, phosphodiesterase III inhibitor pimobendan improved survival, attenuated inflammatory lesions, and decreased production of intracardiac IL-1β, IL-6 and TNF-
and NO [27]. In our recent study of pimobendan, but not the other phosphodiesterase III inhibitors, inhibited the activation of NF-
B [9]. Thus, the inhibition of proinflammatory cytokines and NO production by pimobendan is mediated by its inhibitory effect on the activation of NF-
B.
Most viruses encode proteins that are capable of activating NF-
B. Mice lacking the p50 subunit of NF-
B are resistant to EMCV infection, and fibroblasts from mice lacking p50 have an enhanced induction of interferon-β transcription by infection with EMCV. Therefore, the p50 subunit of NF-
B may down-regulate transcriptional responses that have important consequences on the in vivo response to pathogens [28]. In the present study, EMCV activated NF-
B in cultured non-cardiomyocytes, but not cardiomyocytes. The reason is unclear, but NF-
B activation does not seem to be major pathway in myocytic EMCV infection. In a murine model of EMCV-induced myocarditis, SUN C8079 lowered the mortality of the animals, as well as attenuated myocardial necrosis and cellular infiltration, and decreased the intracardiac production of IL-1β and TNF-
without having a significant effect on viral replication. Although glucorticoids and cyclosporin A inhibit the activation of NF-
B, both agents enhance viral replication, and exacerbate myocardial injury in acute EMCV myocarditis [29,30]. iNOS also has an NF-
B response site in its promoter region [31]. In our previous study, EMCV infection increased the production of NO in macrophages, and its inhibition attenuated the pathologic manifestations of EMCV myocarditis [32].
In the present study, we have shown that SUN C8079 inhibited the LPS-induced NF-
B activation in vitro, and that treatment of mice with SUN C8079 suppressed the production of LPS-induced TNF-
protein, and improved survival in a dose-related manner. These results suggest that the activation of NF-
B is a critical mediator of the LPS-induced injury of multiple organs in vivo. Thus, inhibition of NF-
B activation may represent a novel therapeutic strategy for the treatment of sepsis-induced multiple organ injury. The mechanism of NF-
B inhibition apparently takes place downstream of the signal transduction in the nucleus, since the compound inhibited NF-
B activation as late as 3 h after IL-1β or TNF-
stimulation. However, it did not block the direct binding of NF-
B to NF-
B consensus oligonucleotide (Fig. 2b lane e). Therefore, we hypothesize that a nuclear factor, required for NF-
B activation, is functionally targeted by SUN C8079. Although we did not observe antioxidant effect of SUN C8079 in vitro, in a system generating the superoxide anion, this does not exclude possibility of antioxidant effects on other fee radicals. Studies are underway in our laboratory to identify the target(s) of SUN C8079 inhibition.
Recently, IL-10 was shown to inhibit the induction of NF-
B by LPS in human peripheral blood mononuclear cells, and the result suggests an important link in the understanding of the inhibitory functions of IL-10 toward certain cytokines. Our earlier study showed that exogenous IL-10 inhibited the expression of the iNOS gene, and prolonged the survival of mice with EMCV myocarditis [33]. In more recent experiments, gene transfer of viral IL-10 by electroporation suppressed the induction of IL-1β and iNOS genes, prolonged the survival of mice and attenuated myocardial injury in the same model [34].
Our study suggests that the new NF-
B inhibitor, SUN C8079, may be promising in the treatment of endotoxemia, viral myocarditis and heart failure.
| Acknowledgments |
|---|
|
|
|---|
This work was supported in part by a Research Grant from the Japanese Ministry of Health, Labour and Welfare and a Grant for Scientific Research from the Japanese Ministry of Education, Culture, Sports, Science and Technology. We would like to thank M. Ozone and N. Iguchi for preparing the manuscript.
| References |
|---|
|
|
|---|
- Matsumori A. Molecular and immune mechanisms in the pathogenesis of cardiomyopathy role of viruses, cytokines, and nitric oxide. Jpn Circ J (1997) 61:275–291.[CrossRef][Medline]
- Matsumori A., Yamada T., Suzuki H., Matoba Y., Sasayama S. Increased circulating cytokines in patients with myocarditis and cardiomyopathy. Br Heart J (1994) 72:561–566.
[Abstract/Free Full Text] - Levine B., Kalman J., Mayer L., Fillit H.M., Packer M. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med (1990) 23:236–241.
- Baeuerle P.A., Henkel T. Function and activation of NF-
B in the immune system. Annu Rev Immunol (1994) 12:141–179.[Web of Science][Medline] - Nunokawa Y., Oikawa S., Tanaka S. Human inducible nitric oxide synthase gene is transcriptionally regulated by nuclear factor-
B dependent mechanism. Biochem Biophys Res Commun (1996) 223:347–352.[CrossRef][Web of Science][Medline] - Burkitt M.J., Bishop H.S., Milne, et al. Dithiocabamate toxicity toward thymocytes involves their copper-catalzed conversion to thiuram disulfides, which oxidize glutathione in a redox cycle without the release of reactive oxygen species. Arch Biochem Biophys (1998) 353:73–84.[CrossRef][Web of Science][Medline]
- Nunokawa Y, Suzuki K, Saitoh M. NF-
B inhibitors containing as the active ingredient phenylmethyl benzoquinone. Patent WO9948491. - Peskin A.V., Winterbourn C.C. A microtiter plate assay for superoxide dismutase using a water-soluble tetrazolium salt (WST-1). Clin Chim Acta (2000) 293:157–166.[CrossRef][Web of Science][Medline]
- Matsumori A., Nunokawa Y., Sasayama S. Pimobendan inhibits the activation of transcription factor NF-
B. A mechanism which explains its inhibition of cytokine production and inducible nitric oxide synthase. Life Sci (2000) 67:2513–2519.[CrossRef][Web of Science][Medline] - Green L.C., Wagner D.A., Glogowski J., Skipper P.L., Wishnok J.S., Tannenbaum S.R. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal Biochem (1982) 126:131–138.[CrossRef][Web of Science][Medline]
- Matoba Y., Sherry B., Fields B.N., Smith T.W. Identification of the viral genes responsible for growth of strains of reovirus in cultured mouse heart cells. J Clin Invest (1991) 87:1628–1633.[CrossRef][Web of Science][Medline]
- Nunokawa Y., Ishida N., Tanaka S. Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun (1993) 191:89–94.[CrossRef][Web of Science][Medline]
- Dawn B., Xuan Y.-T., Marian M., et al. Cardiac-specific abrogation of NF-
B activation in mice by transdominant expression of a mutant I
B
. J Mol Cell Cardiol (2001) 33:161–173.[CrossRef][Web of Science][Medline] - Ono K., Matsumori A., Shioi T., Furukawa Y., Sasayama S. Contribution of endothelin-1 to myocardial injury in a murine model of myocarditis. Acute effects of bosentan, an endothelin receptor antagonist. Circulation (1999) 100:1823–1829.
[Abstract/Free Full Text] - Matsumori A., Wang H., Abelmann W.H., Crumpacker C.S. Treatment of viral myocarditis with ribavirin in an animal preparation. Circulation (1985) 71:834–839.
[Abstract/Free Full Text] - Shioi T., Matsumori A., Sasayama S. Persistent expression of cytokine in the chronic stage of viral myocarditis in mice. Circulation (1996) 94:2930–2937.
[Abstract/Free Full Text] - Collins T., Read M.A., Neish A.S., Whitley M.Z., Thanos D., Maniatis T. Transcriptional regulation of endothelial cell adhesion molecules: NF-kappa-B and cytokine-inducible enhancers. FASEB J (1995) 9:899–909.[Abstract]
- Antwerp D.J.V., Martin S.J., Kafri T., Green D.R., Verma I.M. Suppression of TNF-
-induced apoptosis by NF-
B. Science (1996) 274:787–789.[Abstract/Free Full Text] - Xuan Y.-T., Tang X.-L., Banerjee S., et al. Nuclear factor-
B plays an essential role in the late phase of ischemic preconditioning in conscious rabbits. Circulation Res (1999) 84:1095–1109.[Abstract/Free Full Text] - Valen G., Yan Z.-q., Hansson G.K. Nuclear factor Kappa-B and the heart. J Am Cell Cardiol (2001) 38:307–314.[CrossRef]
- Kopp E., Ghosh S. Inhibition of NF-
B by sodium salicylate and aspirin. Science (1994) 265:956–959.[Abstract/Free Full Text] - Yang J.P., Merin J.P., Nakano T., Kat T., Kitade Y., Okamoto T. Inhibition of the DNA-binding activity of NF-
B by gold compounds in vitro. FEBS Lett (1995) 361:89–96.[CrossRef][Web of Science][Medline] - Liu S.F., Ye X., Malik A.B. Inhibition of NF-
B activation by pyrrolidine dithiocarbamate prevents in vivo expression of proinflammatory genes. Circulation (1999) 100:1330–1337.[Abstract/Free Full Text] - Lauzurica P., Martinez-Martinez S., Marazuela M., et al. Pyrolidine dithiocarbamate protects mice from lethal shock induced by LPS or TNF-alpha. Eur J Immunol (1999) 29:1890–1900.[CrossRef][Web of Science][Medline]
- Yamada T., Matsumori A., Sasayama S. Therapeutic effect of anti-tumor necrosis factor-
antibody on the murine model of viral myocarditis induced by encephalomyocarditis virus. Circulation (1994) 89:846–851.[Abstract/Free Full Text] - Wada H., Saito K., Kanda T., et al. Tumor necrosis factor-
(TNF-
) plays a protective role in acute viral myocarditis in mice. A study using mice lacking TNF-
. Circulation (2001) 103:743–749.[Abstract/Free Full Text] - Iwasaki A., Matsumori A., Yamada T., et al. Pimobendan inhibits the production of proinflammatory cytokines and gene expression of inducible nitric oxide synthase in a murine model of viral myocarditis. J Am Coll Cardiol (1999) 33:1400–1407.
[Abstract/Free Full Text] - Sha W.C., Liou H.C., Tuomanen E.I., Baltimore D. Targeted disruption of the p50 subunit of NF-
B leads to multifocal defects in immune responses. Cell (1995) 80:321–330.[CrossRef][Web of Science][Medline] - Tomioka N., Kishimoto C., Matsumori A., Kawai C. Effects of prednisolone on acute viral myocarditis in mice. J Am Coll Cardiol (1986) 7:868–872.[Abstract]
- Monrad E.S., Matsumori A., Murphy J.C., Fox J.G., Crumpacker C.S., Abelmann W.H. Therapy with cyclosporine in experimental murine myocarditis with encephalomyocarditis virus. Circulation (1986) 73:1058–1064.
[Abstract/Free Full Text] - Nunokawa Y., Ishida N., Tanaka S. Promoter analysis of human inducible nitric oxide synthase gene associated with cardiovascular homeostasis. Biochem Biophys Res Commun (1994) 200:802–807.[CrossRef][Web of Science][Medline]
- Wang W.-Z., Matsumori A., Yamada T., et al. Beneficial effects of amlodipine in a murine model of congestive heart failure induced by viral myocarditis: a possible mechanism through inhibition of nitric oxide production. Circulation (1997) 95:245–251.
[Abstract/Free Full Text] - Nishio R., Matsumori A., Shioi T., Ishida H., Sasayama S. Treatment of experimental viral myocarditis with interleukin-10. Circulation (1999) 100:1102–1108.
[Abstract/Free Full Text] - Nakano A., Matsumori A., Kawamoto S., et al. Cytokine gene therapy for myocarditis by in vivo electroporation. Hum Gene Ther (2001) 12:1289–1297.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



