© 2002 European Society of Cardiology
Identification and validation of selective upregulation of ventricular myosin light chain type 2 mRNA in idiopathic dilated cardiomyopathy
a Department of Internal Medicine, Division of Cardiology, University of Jena 07740 Jena, Germany
b Department of Cardiac Surgery, Heart Center NRW, Ruhr-University of Bochum Bad Oeynhausen, Germany
* Corresponding author. Tel.: +49-3641-939-360; fax: +49-3641-939-290. E-mail address: holger.sigusch{at}uni-jena.de
| Abstract |
|---|
|
|
|---|
Background and aims: the etiology of idiopathic dilated cardiomyopathy (IDCM) is unknown, methods such as suppression subtractive hybridization (SSH) and DNA microarray technology can help to identify genes which might be involved in the pathogenesis of this disease.
Methods and results: we used SSH which compared mRNA populations extracted from the left ventricular tissue of IDCM hearts and from the control tissue to identify sequences which correspond to genes up-regulated in IDCM. We identified ventricular myosin light chain type 2 (MLC2V), skeletal
-actin, long-chain-acyl-CoA-synthetase and mRNA for the protein KIAA0465 as differentially up-regulated genes. Expression of MLC2V mRNA was determined by RT-PCR in patients with end-stage heart failure caused by IDCM (n=11) or coronary artery disease (CAD, n=9) who underwent heart transplantation as well as the controls (n=6). MLC2V/GAPDH ratios were 2.95±0.32, 0.69±0.03 and 0.28±0.08 (arbitrary unit) for the IDCM group, the CAD group and controls, respectively (P<0.05). DNA microarray analysis confirmed the finding of MLC2V upregulation in IDCM (3.7- and 1.8-fold increase in MLC2V mRNA).
Conclusions: we have demonstrated that SSH is a useful method to identify differential myocardial upregulation of genes. Upregulation of MLC2V can be judged as a specific IDCM related feature, which might be clinically helpful.
Key Words: Cardiomyopathy Candidate genes Subtractive hybridization DNA microarray Myosin light chain
Received March 22, 2001; Revised June 25, 2001; Accepted September 7, 2001
| 1. Introduction |
|---|
|
|
|---|
Dilated cardiomyopathy is characterized by the dilation and impaired contractility of either the left or both ventricles [1]. According to this classification, idiopathic, familial-genetic, viral autoimmune, toxic and forms associated with other cardiovascular diseases are distinguished [2–6]. In the clinical setting however, most cases remain unclear — idiopathic — in aetiological terms. The so-called target gene approach uses methods that investigate genes with a suspected relation to the disease process per se and are therefore, limited to known genes thought to be involved in the pathogenesis of the disease of interest. Recognizing these limitations, approaches have been developed to screen for differentially expressed genes and related proteins.
A large repertoire of techniques for the identification of differential transcripts comparing two mRNA populations, particularly differential display and related techniques that include amplification of sequences by random priming followed by electrophoretic separation have been developed [7–9]. Although their application has led to the successful identification of important genes such as the T-cell receptor [10] or tumor suppressor genes [11] there is a significant incidence of false positives and it is difficult to isolate rare transcripts that are differentially expressed. The method of suppression subtractive hybridization (SSH), described in 1996 for the first time, was developed for the generation of subtracted cDNA libraries [12] and is based on the suppression PCR effect [13]. SSH overcomes the problem of differences in mRNA abundance by incorporating the first hybridization step that equalizes high- and low-abundance sequences due to the second-order kinetics of hybridization [12]. The method also eliminates any intermediate step for physical separation of ss and ds cDNAs, requires only one round of SSH and virtually excludes the isolation of false positive and false negative clones [12,14].
In this study we used SSH for identification of differentially up-regulated genes in idiopathic dilated cardiomyopathy (IDCM). Among other genes we identified MLC2V as an in IDCM up-regulated gene. This upregulation has been validated by quantitative RT-PCR and DNA microarray technology and was found to be a specific feature of IDCM.
| 2. Methods |
|---|
|
|
|---|
2.1. Subjects and RNA isolation for SSH
We used human left ventricular tissue, obtained from four male IDCM patients (age range 43–54 years; see Table 1, patient numbers 7, 10, 5 and 1) undergoing heart transplantation because of end-stage heart failure and two male donor hearts (age of donors 48 and 49 years, respectively) with normal left ventricular function, which could not be used for heart transplantation (see below). The study protocol was approved by the ethics committee at the Medical Faculty of the University of Jena. IDCM was diagnosed according to the criteria of the World Health Organization/International Society and Federation of Cardiology Task Force [1]. In detail, in addition to reduced left ventricular ejection fraction, patients did not show any angiographic evidence of coronary artery disease, ischemic changes during exercise testing, systemic hypertension, valvular or pericardial heart disease or a history of excessive alcohol consumption. Total RNA from approximately 120 mg tissue each were isolated according to the RNeasyTM protocol (QIAGEN); poly(A)+ RNA required for the SSH were isolated from total RNA using a mRNA purification kit (OLIGOTEX).
|
2.2. Driver/tester preparation and suppression subtractive hybridization
Driver ds cDNA was synthesized from 2 µg human poly(A)+RNA, using the PCR-SelectTM cDNA subtraction kit (CLONTECH). First- and second-strand cDNA syntheses were carried out according to the manufacturer's protocol. After purification (all reagents from QIAGEN) the resulting cDNA pellet was dissolved in 50 µl of deionized water and digested by RsaI in a 50 µl reaction mixture containing 15 units of enzyme (CLONTECH) for 1.5 h. The cDNA was again purified and resuspended in 5.5 µl of deionized water. Two microliters of 1:5 diluted tester cDNA was then ligated to 2 µl of adapter 1 and adapter 2R (10 µM) in separate ligation reactions in a total volume of 10 µl at 16 °C overnight, using 400 units of T4 DNA ligase (CLONTECH). After ligation, the samples were heated at 72 °C for 5 min to inactivate the ligase and stored at –20 °C.
After a first hybridization according to manufacturer's instructions, the two samples were combined, a fresh portion of heat-denatured driver (1 µl) in 1 µl of hybridization buffer was added and again allowed to hybridize.
2.3. PCR amplification
The primary PCR was conducted in 25 µl containing 1 µl of diluted, subtracted cDNA, 1 µl of PCR primer P 1 (5'-CTAATACGACTCACTATAGGGC-3'; 10 µM) and 23 µl of PCR master mixture (CLONTECH). It was performed under the following conditions: 75 °C for 5 min; 95 °C for 1 min; 30 cycles at (95 °C for 30 s; 63 °C for 45 s; 72 °C for 1.5 min); and a final extension at 72 °C for 5 min. The amplified product was diluted tenfold in deionized water. One microliter was then used as the template in secondary PCR for 12 cycles (annealing at 66 °C) under the same conditions used for the primary PCR, except PCR primer P 1 was replaced with nested primers PN 1 (5'-TCGAGCGGCCGCCCGGGCAGGT-3') and PN 2R (5'AGCGTGGTCGCGGCCGAGGT-3'), respectively. The PCR products were analyzed by 2% SFR agarose gel electrophoresis.
2.4. Cloning and analysis of the subtracted cDNA
After gel purification (QIAGEN) products from the secondary PCR were inserted into pT-Adv using a PCR cloning kit (CLONTECH). DNA sequencing was performed by the chain termination reaction manually using a sequencing kit from Amersham Pharmacia, the sequence was detected by a chemiluminescence detection kit (New England BioLabs). Nucleic acid homology searches were performed using the BLAST algorithm [15].
2.5. Quantification of MLC2V mRNA by RT-PCR
For the validation of MLC2V, upregulation explanted tissue obtained at the time of heart transplantation was used. Left ventricular samples of 11 patients with end-stage heart failure due to IDCM (see Table 1 for details) and of nine patients with end-stage heart failure due to CAD (noninfarcted regions) were used to determine MLC2V mRNA expression by RT-PCR. There were no significant differences regarding basic demographic and hemodynamic variables between the two heart failure groups (IDCM vs. CAD). In detail, the mean ages were 55±3.0 (IDCM) versus 59±2.0 years (CAD; P=0.26), mean NYHA functional classes were 3.4±0.15 (IDCM) vs. 3.4±0.17 (CAD, P=0.73), mean left ventricular ejection fractions obtained by ventriculography were 19±2.0 (IDCM) vs. 24±1.4 (CAD, P=0.08), mean left ventricular enddiastolic diameters determined by echocardiography were 70±2.2 (IDCM) vs. 75±2.4 (CAD, P=0.08) and the serum creatinine concentrations were 106±9 IDCM vs. 121±13 µmol/l (CAD, P=0.36). Left ventricular samples of six donor hearts which could not be used for heart transplantation served as controls. The mean age of controls (all male) was 53±3.3 years (range 39–63 years). The brain death of donors resulted from subarachnoid hemorrhage (two cases), intracranial hemorrhage (two cases) or head injury (two cases). Left ventricular function was normal by echocardiography study.
The left ventricular tissue was obtained from the left ventricular free wall-excluding macroscopic scars especially in CAD patients who all had prior myocardial infarction (see Table 1).
The input of cDNA (obtained through reverse transcriptase reaction) was equilibrated using competitive RT-PCR after construction of a competitor fragment with primer binding sites for the housekeeping gene glyceraldehyde-3-phospho-dehydrogenase (GAPDH) as described before, except the GAPDH primer pair was replaced with new GAPDH primers for a 474 bp product (5'AGCCACATCGCTCAGAACAC 3';5'GAGGCATTGCTGATGATCTTG 3') [16]. For quantification of MLC2V mRNA after equalization of cDNA input, the following primer pair was used: 5'AAAG
CAAAGAAGAGAGCC-3'; 5'-GTGACCAAATACACGACC-3'; each of 200 nM. The resulting PCR products were separated and analyzed by videodensitometry (see above). The identity of this PCR product was verified by sequencing.
2.6. DNA microarray analysis
We used this method in addition to quantitative RT-PCR to compare left ventricular tissue obtained from end-stage IDCM and control tissue at expression level. The commercially available service of Genomesystems Inc. (St. Louis, MO) was used.
We compared two male IDCM patients with the same control heart. The subjects were 52, 55 (IDCM) and 53 (control) years old. The necessary RNA was extracted according to the TRIZOL protocol of Gibco BRL Life Technologies (Eggenstein, Germany) — a method modified according to Chomczynski and Sacchi [17].
2.7. Statistics
Results are given as mean±S.E. For the comparison of more than two groups (IDCM, ischemic cardiomyopathy and controls) a t-test for multiple samples with
-correction (Bonferroni test) was used. P<0.05 was considered a significant difference. All calculations were done using the computer program SPSS for Windows, version 6.1.
| 3. Results |
|---|
|
|
|---|
3.1. Suppression subtractive hybridization
After cDNA synthesis we identified differentially up-regulated genes using the SSH technique. Four fragments representing differentially up-regulated sequences were isolated following agarose gel electrophoresis. These sequences were further enriched by nested PCR amplification and separated again by agarose gel electrophoresis, which identified an additional differentially expressed sequence (Fig. 1). A total of five sequences with fragment lengths between 250 and 700 bp were finally excised from the gel, purified, cloned in a pT-Adv vector and sequenced after amplification in E. coli. Sequencing and sequence comparison revealed the following differentially up-regulated genes: myosin light chain type 2, ventricular isoform (MLC2V); skeletal
-actin (two isolates); long-chain-acyl-CoA-synthetase and mRNA for the protein KIAA0465 (Table 2).
|
|
3.2. Validation of MLC2V upregulation in explanted IDCM tissue
Using quantitative RT-PCR MLC2V mRNA expression was determined in 11 patients with end-stage IDCM, non-infarcted tissue from nine patients with coronary artery disease and end-stage heart failure and six controls with normal left ventricular function. The detailed results of RT-PCR are shown in Fig. 2. Individual MLC2V/GAPDH ratios were significantly higher in IDCM patients (2.95±0.32 arbitrary unit) in comparison to patients with end-stage heart failure caused by coronary artery disease (0.69±0.03) and controls with unimpaired left ventricular function (0.28±0.08). MLC2V mRNA expression in IDCM was 4.3-fold and 9.8-fold higher when compared to coronary artery disease and controls, respectively. Results are summarized in Fig. 3.
|
|
3.3. Confirmation of MLC2V upregulation by DNA microarray technology
DNA microarray technology was further used to confirm upregulation of mRNA MLC2V in left ventricular IDCM tissue obtained at the time of heart transplantation. Two mRNA populations extracted from two different male patients with IDCM were therefore compared to mRNA population extracted from the same control individual with normal left ventricular function. We found a balanced overexpression of 3.7 and 1.8 of MLC2V mRNA for the two IDCM patients (see Fig. 4). For atrial natriuretic peptide — a gene with known upregulation in failing human heart in the sense of an activation of an embryonic gene program — we found a balanced overexpression of 8.5- and 6.5-fold (Fig. 4).
|
| 4. Discussion |
|---|
|
|
|---|
Identification of genes responsible for phenotypic differences between tissues requires methods which efficiently compare the mRNA populations between the two samples and which allow isolation of differentially expressed transcripts found in only one sample. The method of suppression subtractive hybridization provides the molecular basis for such a comparison. To identify changes in myocardial gene expression patterns we subtracted mRNA populations extracted from left ventricular tissue from individuals with end-stage IDCM (tester sample) against mRNA populations from age and sex matched controls — with normal left ventricular function (driver sample). Ultimately, we were able to enrich sequences up-regulated in IDCM.
We identified the following genes as being up-regulated in IDCM: ventricular myosin light chain type 2, skeletal
-actin, long-chain-acyl-CoA-synthetase, and KIAA0465.
The myocardial upregulation of skeletal
-actin mRNA in heart failure has been described before and is thought to be part of a reactivation of fetal genes [18,19]. In addition, the expression of this gene has been described in human heart libraries drawn from fetal hearts and cardiomyopathy [20]. Therefore, upregulation of skeletal
-actin in IDCM can be seen as an established marker of fetal reactivation occurring in heart failure.
Under normal conditions fatty acids are the source for generation of energy rich phosphate compounds in the heart. Monogene defects of enzymes catalyzing β-oxidation of fatty acids leading to the picture of dilated cardiomyopathy have been described [21]. In the course of heart failure changes in the expression of genes responsible for fatty acid β-oxidation have been reported. LPS or TNF-
challenge in a Syrian hamster leads to downregulation of long-chain-acyl-CoA synthetase [22]. In heart failure a substrate switch from fatty acids to glucose occurs and a downregulation of enzymes of fatty acid β-oxidation takes place [23]. Collectively, these data indicate that these enzymes are regulated by inflammatory influences and in the context of heart failure. By SSH we identified long-chain-acyl-CoA-synthetase as being up-regulated in end-stage IDCM. Using RT-PCR we were, however, not able to verify this result (data not shown). There were no differences regarding mRNA expression between end-stage IDCM, end-stage coronary artery disease and controls with regular left ventricular function.
The mRNA sequence of the protein KIAA0465 was identified in 1997 (AB007934 [GenBank] , EMBL-genbank, 08/1997; Robert Straussberg, National Cancer Institute, USA). There are no data available describing the physiological function of this protein.
The successful identification of MLC2V was demonstrated clearly by our quantitative RT-PCR and by DNA microarray technology. RT-PCR results demonstrated a substantial upregulation of MLC2V mRNA in IDCM in comparison to controls and ischemic cardiomyopathy. There was no statistically significant difference between the ischemic cardiomyopathy and control groups. DNA microarray technology further confirmed RT-PCR data and showed clear upregulation of atrial natriuretic factor mRNA as a part of fetal reactivation serving as an internal control.
Myosin is the force generator in muscle contraction. It is an asymmetric molecule with a globular head and a rod-like tail. The sarcomeric myosin complex provides the molecular motor for cardiac force generation, and each myosin hexamer is composed of two myosin heavy chains, two essential MLC1/3 molecules, and two regulatory MLC2 molecules [24]. In smooth muscle and nonmuscle myosin MLC2 plays an important role in regulation of ATPase activity via Ca2+-dependent phosphorylation [25]. In contrast, in skeletal and cardiac muscle the actin–myosin interaction is controlled in a Ca2+-dependent manner by the troponin/tropomyosin complex [19]. At low levels of Ca2+ activation an increase in force generation results from MLC2 phosphorylation. Removal of MLC2 from the myosin hexamer decreases the speed of actin movement on skeletal myosin [26].
Rare human hypertrophic cardioymopathies that are the result of point mutations close to the phosphorylation site of MLC2V have been described [25].
In a model of transgenic overexpression of MLC2F (skeletal muscle form) in the heart endogenous MLC2 mRNA levels have been found not to be affected despite high expression of this gene [27,28]. Furthermore, the sarcomeric protein stoichiometry did not change despite the increase in mRNA, indicating that MLC2 protein content is regulated by post-transcriptional mechanisms. In the atria a complete isoform switch towards MLC2F was found, whereas in the ventricles a maximum of 55% of MLC2 replacement was obtained. The relative affinities of MLC2 isoforms for MLC binding
-helical region of
-MHC was postulated to be MLC2V>MLC2F>MLC2A. The complete replacement of MLC2A and the partial replacement of MLC2V by MLC2F resulted in a reduced contractility and impaired diastolic function in transgenic hearts.
The study of transgenic mice with a disrupted gene for MLC2V resulted in death on day 12.5 in the embryonic development [29]. Replacement of the lacking ventricular isoform by the atrial isoform could not prevent the development of severely depressed left ventricular function (resembling dilated cardiomyopathy, day 11.5 of embryos) and progressive embryonic heart failure and death at day 12.5. Loss of ventricular myosin light chain type 2 in this model was in addition associated with myofibrillar disorganization of the normal parallel alignment of thick and thin filaments, indicating that there is a selective requirement for MLC2V in the normal development of ventricular cardiac myocyte structure and function.
A 30–90% reduction of MLC2V protein associated with a twofold reduction of ATP binding and hydrolysis rates of myofilaments in human IDCM has been described [30]. This finding was linked to increased expression of a MLC2V specific protease. This putative protease could not be detected in healthy donor hearts. A 2D electrophoresis study of left ventricular tissue from 28 IDCM patients could confirm a 50% reduction of the MLC2V protein [31]. Because an increase of MLC2V fragment was detected simultaneously, a proteolytic degradation of MLC2V protein in IDCM is further substantiated.
We demonstrated that — in contrast to CAD — in IDCM MLC2V mRNA is selectively up-regulated. This finding might be clinically useful based on the evaluation of endomyocardial biopsy tissue. However, we have to consider that the patients we studied were suffering from far-advanced stages of heart failure (all NYHA class III and IV) and therefore cannot simply applied to IDCM patients with better preserved left ventricular function. In addition, it is not clear whether MLC2V mRNA up-regulation is able to distinguish IDCM from left ventricular dysfunction due to other etiologies, e.g. valvular cardiomyopathy, too.
In conclusion, we have demonstrated that SSH is a useful method to identify differential myocardial upregulation of genes. Upregulation of MLC2V can be judged as a specific IDCM related feature. MLC2V has a complex role in maintaining cardiac myofibrillar integrity under normal conditions. Despite the here described dramatic up-regulation of MLC2V mRNA a reduction of MLC2V myocardial protein content occurs. MLC2V mRNA upregulation can therefore be seen as an inadequate compensatory mechanism, since MLC2V protein content is regulated by post-transcriptional mechanisms. However — since IDCM specific — this finding might be clinically helpful, based on the evaluation of endomyocardial biopsies.
| Acknowledgements |
|---|
We wish to thank Ulla-Brigitte Köhler for excellence in technical assistance and Dr E. Birch-Hirschfeld for oligonucleotide synthesis. We are indebted to Jacqueline Weber, for the design of the MLC2V primers. This work was supported by the Deutsche Forschungsgemeinschaft SI 616/2-1.
| References |
|---|
|
|
|---|
- Richardson P, McKenna W, Bristow M, Maisch B, Mautner B, O'Connell J, Olsen E, Thiene G, Goodwin J, Gyarfas I, Martin I, Nordet P. Report of the 1995 World Health Organization/International Society and Federation of Cardiology Task Force on the Definition and Classification of cardiomyopathies. Circulation 1996;93:841–2.
- Graham R.M., Owens W.A. Pathogenesis of inherited forms of dilated cardiomyopathy. N. Engl. J. Med. (1999) 341:1759–1762.
[Free Full Text] - Fatkin D., MacRae C., Sasaki T., Wolff M.R., Porcu M., Frenneaux M., Atherton J., Vidaillet H.J. Jr, Spudich S., De Girolami U., Seidman J.G., Seidman C.E., Muntoni F., Muehle G., Johnson W., McDonough B. Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N. Engl. J. Med. (1999) 341:1715–1724.
[Abstract/Free Full Text] - Bowles N.E., Richardson P.J., Olsen E.G., Archard L.C. Detection of coxsackie-B-virus-specific RNA sequences in myocardial biopsy samples from patients with myocarditis and dilated cardiomyopathy. Lancet (1986) 1:1120–1123.[Web of Science][Medline]
- Kandolf R., Ameis D., Kirschner P., Canu A., Hofschneider P.H. In situ detection of enteroviral genomes in myocardial cells by nucleic acid hybridization: an approach to the diagnosis of viral heart disease. Proc. Natl. Acad. Sci. USA (1987) 84:6272–6276.
[Abstract/Free Full Text] - Caforio A.L., McKenna W.J. Dilated cardiomyopathy: chronic viral infection or autoimmune disease? A critical view of the viral and the autoimmune hypotheses. Indian Heart J. (1990) 42:399–402.[Medline]
- Hubank M., Schatz D.G. Identifying differences in mRNA expression by representational difference analysis of cDNA. Nucleic Acids Res. (1994) 22:5640–5648.
[Abstract/Free Full Text] - Liang P., Averboukh L., Keyomarsi K., Sager R., Pardee A.B. Differential display and cloning of messenger RNAs from human breast cancer versus mammary epithelial cells. Cancer Res. (1992) 52:6966–6968.
[Abstract/Free Full Text] - Liang P., Pardee A.B. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science (1992) 257:967–971.
[Abstract/Free Full Text] - Hedrick S.M., Cohen D.I., Nielsen E.A., Davis M.M. Isolation of cDNA clones encoding T cell-specific membrane-associated proteins. Nature (1984) 308:149–153.[CrossRef][Medline]
- Wu G.S., Kar S., Carr B.I. Identification of a human hepatocellular carcinoma-associated tumor suppressor gene by differential display polymerase chain reaction. Life Sci. (1995) 57:1077–1085.[CrossRef][Web of Science][Medline]
- Diatchenko L., Lau Y.F., Campbell A.P., Chenchik A., Moqadam F., Huang B., Lukyanov S., Lukyanov K., Gurskaya N., Sverdlov E.D., Siebert P.D. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA (1996) 93:6025–6030.
[Abstract/Free Full Text] - Gurskaya N.G., Diatchenko L., Chenchik A., Siebert P.D., Khaspekov G.L., Lukyanov K.A., Vagner L.L., Ermolaeva O.D., Lukyanov S.A., Sverdlov E.D. Equalizing cDNA subtraction based on selective suppression of polymerase chain reaction: cloning of Jurkat cell transcripts induced by phytohemaglutinin and phorbol 12-myristate 13-acetate. Anal. Biochem. (1996) 240:90–97.[CrossRef][Web of Science][Medline]
- von Stein O.D., Thies W.G., Hofmann M. A high throughput screening for rarely transcribed differentially expressed genes. Nucleic Acids Res. (1997) 25:2598–2602.
[Abstract/Free Full Text] - Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z., Miller W., Lipman D.J. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. (1997) 25:3389–3402.
[Abstract/Free Full Text] - Lehmann M.H., Kühnert H., Müller S., Sigusch H.H. Monocyte chemoattractant protein 1 (MCP-1) gene expression in dilated cardiomyopathy. Cytokine (1998) 10(10):739–746.[CrossRef][Web of Science][Medline]
- Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. (1987) 162:156–159.[Web of Science][Medline]
- Adachi S., Ito H., Tamamori M., Tanaka M., Marumo F., Hiroe M. Skeletal and smooth muscle alpha-actin mRNA in endomyocardial biopsy samples of dilated cardiomyopathy patients. Life Sci. (1998) 63:1779–1791.[CrossRef][Web of Science][Medline]
- Aoki H., Sadoshima J., Izumo S. Myosin light chain kinase mediates sarcomere organization during cardiac hypertrophy in vitro. Nat. Med. (2000) 6:183–188.[CrossRef][Web of Science][Medline]
- Hwang D.M., Dempsey A.A., Wang R.X., Rezvani M., Barrans J.D., Dai K.S., Wang H.Y., Ma H., Cukerman E., Liu Y.Q., Gu J.R., Zhang J.H., Tsui S.K., Waye M.M., Fung K.P., Lee C.Y., Liew C.C. A genome-based resource for molecular cardiovascular medicine: toward a compendium of cardiovascular genes. Circulation (1997) 96:4146–4203.
[Abstract/Free Full Text] - Strauss A.W., Johnson M.C. The genetic basis of pediatric cardiovascular disease. Semin. Perinatol. (1996) 20:564–576.[CrossRef][Web of Science][Medline]
- Memon R.A., Fuller J., Moser A.H., Smith P.J., Feingold K.R., Grunfeld C. In vivo regulation of acyl-CoA synthetase mRNA and activity by endotoxin and cytokines. Am. J. Physiol. (1998) 275:E64–72.[Web of Science][Medline]
- Sack M.N., Kelly D.P. The energy substrate switch during development of heart failure: gene regulatory mechanisms. Int. J. Mol. Med. (1998) 1:17–24.[Web of Science][Medline]
- Rayment I., Holden H.M., Whittaker M., Yohn C.B., Lorenz M., Holmes K.C., Milligan R.A. Structure of the actin–myosin complex and its implications for muscle contraction. Science (1993) 261:58–65.
[Abstract/Free Full Text] - Poetter K., Jiang H., Hassanzadeh S., Master S.R., Chang A., Dalakas M.C., Rayment I., Sellers J.R., Fananapazir L., Epstein N.D. Mutations in either the essential or regulatory light chains of myosin are associated with a rare myopathy in human heart and skeletal muscle. Nat. Genet. (1996) 13:63–69.[CrossRef][Web of Science][Medline]
- Margossian S.S. Reversible dissociation of dog cardiac myosin regulatory light chain 2 and its influence on ATP hydrolysis. J. Biol. Chem. (1985) 260:13747–13754.
[Abstract/Free Full Text] - Gulick J., Hewett T.E., Klevitsky R., Buck S.H., Moss R.L., Robbins J. Transgenic remodeling of the regulatory myosin light chains in the mammalian heart. Circ. Res. (1997) 80:655–664.
[Abstract/Free Full Text] - Pawloski-Dahm C.M., Song G., Kirkpatrick D.L., Palermo J., Gulick J., Dorn G.W. II, Robbins J., Walsh R.A. Effects of total replacement of atrial myosin light chain-2 with the ventricular isoform in atrial myocytes of transgenic mice. Circulation (1998) 97:1508–1513.
[Abstract/Free Full Text] - Chen J., Kubalak S.W., Minamisawa S., Price R.L., Becker K.D., Hickey R., Ross J. Jr, Chien K.R. Selective requirement of myosin light chain 2v in embryonic heart function. J. Biol. Chem. (1998) 273:1252–1256.
[Abstract/Free Full Text] - Margossian S.S., White H.D., Caulfield J.B., Norton P., Taylor S., Slayter H.S. Light chain 2 profile and activity of human ventricular myosin during dilated cardiomyopathy. Identification of a causal agent for impaired myocardial function. Circulation (1992) 85:1720–1733.
[Abstract/Free Full Text] - Corbett J.M., Why H.J., Wheeler C.H., Richardson P.J., Archard L.C., Yacoub M.H., Dunn M.J. Cardiac protein abnormalities in dilated cardiomyopathy detected by two-dimensional polyacrylamide gel electrophoresis. Electrophoresis (1998) 19:2031–2042.[CrossRef][Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

DNA and HaeIII digest of phage 



