Skip Navigation

European Journal of Heart Failure 2001 3(4):415-421; doi:10.1016/S1388-9842(01)00137-4
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Plenz, G.
Right arrow Articles by Deng, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plenz, G.
Right arrow Articles by Deng, M. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2001 European Society of Cardiology

Activation of the cardiac interleukin-6 system in advanced heart failure

Gabriele Plenza,b,c,*, Zhi Fang Songa, Tonny D.T. Tjana, Carsten Koenigc, Hideo A. Babad, Michael Errene, Markus Fleschf, Thomas Wichterb, Hans H. Schelda,g and Mario C. Denga,h

a Department of Cardiothoracic Surgery, University of Muenster Albert-Schweitzer-Str. 33, D-48129 Muenster, Germany
b Department of Cardiology and Angiology, University of Muenster Albert-Schweitzer-Str. 33, D-48129 Muenster, Germany
c Institute for Arteriosclerosis Research, University of Muenster Domagkstr. 3, D-48149 Muenster, Germany
d Gerhard-Domagk-Institute of Pathology, University of Muenster Domagkstr. 17, D-48149 Muenster, Germany
e Institute for Clinical Chemistry and Laboratory Medicine, University of Muenster Albert-Schweitzer-Str. 33, D-48129 Muenster, Germany
f Department of Internal Medicine — Cardiology, University of Cologne Cologne, Germany
g Muenster University Transplant Center, Muenster University Muenster, Germany
h Columbia University, College of Physicians and Surgeons New York, NY, USA

* Corresponding author. Department of Cardiothoracic Surgery, University of Muenster, Albert-Schweitzer-Str. 33, D-48129 Muenster, Germany. Tel.: +49-251-835-6425; fax: +49-251-835-2998. E-mail address: plenz{at}uni-muenster.de (G. Plenz).


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objectives: The study objective was to assess the cardiac expression of interleukin-6 (IL6) and its receptor (IL6R) in advanced heart failure.

Background: While IL6 plasma levels are elevated and associated with an impaired prognosis in advanced heart failure, little is known about the intracardiac expression of the IL6 system.

Methods: Heart tissue was obtained from 20 patients (n = 10, idiopathic dilated cardiomyopathy, age 44±15 years; n = 10, ischemic cardiomyopathy, age 55±8 years) at the time of transplantation. Left and right ventricular tissue was subjected to in situ hybridization, Northern blot analysis, and RT-PCR. Signals were quantified by densitometric scanning and corrected for G3PDH-mRNA levels. Right ventricular biopsy specimens (n = 11) of patients with arrhythmias and normal cardiac function served as controls. In addition, data were correlated with cardiac catheterization and echocardiography data obtained at transplant evaluation.

Results: Ventricular IL6 and IL6R transcripts were detected in all explant specimens examined. Expression of both mRNA species was higher than in controls (P = 0.001). Left ventricular IL6 mRNA levels correlated positively with heart rate (r = 0.77; P = 0.009), pulmonary capillary wedge pressure (r = 0.53; P = 0.03), right atrial pressure (r = 0.77; P = 0.003), and inversely with left ventricular ejection fraction (r = –0.61; P = 0.03). Right ventricular IL6 mRNA levels correlated inversely with cardiac index (r = –0.48; P = 0.05). IL6R expression did not correlate with hemodynamic data.

Conclusions: In advanced heart failure, cardiac IL6/IL6R mRNA expression is increased and may play a role in the pathophysiology of advanced heart failure.

Key Words: Interleukin-6 • Heart failure • Cardiomyopathy • Hemodynamics

Received December 5, 2000; Revised January 12, 2001; Accepted February 12, 2001


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
The observation of elevated tumor necrosis factor-{alpha} (TNF{alpha}) levels in advanced heart failure [1] has led to the appreciation of the role of proinflammatory cytokines in the pathogenesis of this syndrome [2]. Elevated systemic interleukin-6 (IL6) plasma levels [35] associated with an impaired prognosis [6] were since reported. IL6 belongs to a family of pleiotropic and evolutionary conserved cytokines involved in the regulation of stem cells, hematopoiesis, thrombopoiesis, macrophage function, neuron function, acute phase response, bone metabolism, and cardiac hypertrophy. The family includes besides IL6 the cytokines IL11, cardiotrophin-1, oncostatin-M, leukemia-inhibitory factor, and ciliary neurotrophic factor which all utilize a common signal transducing component named gp130 besides their cytokine specific receptors [7]. Recently, elevated soluble IL6 receptor (IL6R) levels in heart failure have been reported [8]. Circulating IL6 exerts a negative inotropic influence on isolated papillary muscle preparations in the hamster model [9] and in atrial strips in humans [10], potentially modulated by the nitric oxide [9,10], β-adrenoceptor pathway [11,12], and the ceramide-sphingomyelin pathway [13]. Serum IL6 levels correlate with reduced contractility, elevated preload, elevated heart rate, and reduced afterload in patients with impaired left ventricular function [14,15]. Regarding the source of IL6 production, recent murine transgene and knockout data suggest that an intracardiac IL6/gp130 system exists and is an essential component in the compensatory response to hemodynamic overload [1618]. Human myocardium has been suggested to be a source of IL6 during myocardial infarction [19], ischemia [20], reperfusion [21], rejection [22,23], and heart failure [24]. In the present study of patients undergoing cardiac transplantation, we sought to elucidate the cardiac expression of this proinflammatory cytokine and its receptor as well as their potential association with impaired cardiac performance.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1. Patients
Twenty patients (n=10, idiopathic dilated cardiomyopathy, 5/5 m/f, age 44±15 years; n=10, ischemic cardiomyopathy, 9/1 m/f, age 55±8 years) who underwent transplantation between January 1994 and June 1997 in our institution were included in the study. Preoperative patient characteristics are summarized in Table 1. Transplant evaluation was performed on optimal oral heart failure therapy consisting of angiotensin-converting enzyme inhibitors, diuretics, and digitalis if applicable, on average 6.2±3.5 months before transplantation. In all patients, diagnosis was established by left heart catheterization and coronary arteriography. Right heart catheterization and echocardiography were performed under standardized conditions. The protocol was approved by the ethics committee of Muenster University Hospital.


View this table:
[in this window]
[in a new window]

 
Table 1 Patient baseline characteristics before transplantationa

 
2.2. Cardiac tissue procurement
Myocardial samples were retrieved in the operating room immediately after native hearts had been excised for orthotopic cardiac transplantation. Immediately after removal, specimens representing the left and right ventricle were snap frozen in liquid nitrogen. Care was taken in ischemic cardiomyopathy patients to avoid sampling of scarred areas. Until use the tissue was stored at –80°C. Atrial tissue was not included because adequate samples were available in less than 50% of patients.

2.3. Control tissue
Right ventricular biopsy specimens (n=11) of patients undergoing evaluation for complex ventricular arrhythmias with normal cardiac function (arrhythmogenic right ventricular cardiomyopathy n=4, Brugada syndrome n=5, idiopathic ventricular fibrillation n=2) served as controls.

2.4. Probe preparation, RNA extraction and Northern blot analysis
For Northern blot and in situ hybridization IL6 cRNA probes were used. The recombinant cDNA clones hIL6, containing an insert complementary to the human IL6 mRNA (R&D-Systems, Bad Nauheim, Germany) and glyceraldehyde-3-phosphate-dehydrogenase (G3PDH, Clontech, Heidelberg, Germany) complementary to G3PDH mRNA, were used. For in vitro transcription, the IL6 cDNA was subcloned into the pGEM3Z vector [24]. The in vitro transcription was performed according to the manufacturer's protocol using digoxigenin-labeled-UTP (Boehringer, Mannheim, Germany). Total RNA was isolated from the tissue according to an established protocol [25]. Northern blot analysis was performed as previously described [26]. In brief, membranes containing 10 µg total RNA per sample were hybridized at 72°C in hybridization solution with a probe concentration of 50 ng/ml. Detection was performed using a modified detection protocol (Boehringer, Mannheim, Germany) and the chemoluminogenic substrate CSPD®. Luminographs were quantitated by densitometric scanning (Personal Densitometer, Molecular Dynamics, Krefeld, Germany). Densitometric values of IL6 mRNA expression were corrected for G3PDH mRNA values. Data are presented as optical density (OD) ratio of IL6 mRNA/G3PDH mRNA. The number of specimens removed and the relative OD values (compared to G3DPH mRNA) are summarized in Table 2.


View this table:
[in this window]
[in a new window]

 
Table 2 Intraventricular IL6 mRNA expression data in 20 individual patients undergoing cardiac transplantation (arbitrary densitometric units of optical density IL6/G3PDH mRNA ratio)a

 
2.5. In situ hybridization
In situ hybridization was performed in control biopsy and explant specimens on delipidized (incubation in chloroform for 10 min) cryostat sections (10 µm) following methods modified from those previously described [21]. Hybridization was done overnight at 52°C with 1 µg digoxigenin-labeled IL6 antisense or sense riboprobe/ml hybridization solution. Prior to the detection procedure sections were treated with RNAse to eliminate non-specific background hybridization of RNA molecules (10 µg/ml, incubation for 10 min at 37°C). Detection was done using the anti-digoxigenin alkaline phosphatase system according to the manufacturer's instructions (Boehringer, Mannheim). The staining procedure was performed in the dark overnight using nitroblue tetrazolium salt (67.5 mg/ml; Biomol, Hamburg, Germany) and 5-bromo-4-chloro-3-indolyl phosphate (35 mg/ml; Biomol, Hamburg, Germany) as substrates. Sections were counterstained with methylene green and mounted with Kaiser's glycerine gelatine. To evaluate potential background from the hybridization and detection procedure, slides were incubated with hybridization solution only. In general, background was not observed. The sections were examined using standard brightfield optics (250x) and documented with the IP-Image system. Final images were transferred in binary format for analysis using the Scion image software. Thresholds for detection on a 255-point gray scale were adjusted to reduce any background from cell boundaries, nuclei and to eliminate lipofuscin spots. The total remaining pixels were automatically counted to yield the total area (µm2) of the signal per image.

2.6. Reverse-transcription polymerase chain reaction
IL6, IL6R and G3PDH mRNAs in control and explant tissue were assessed by RT-PCR. In brief, 1 µg of total RNA from human myocardium was reverse transcribed using Superscript II according to the manufacturer's instructions (Gibco BRL; Life Technologies GmbH, Eggenstein, Germany). The RT products (5 µl) were brought to a volume of 50 µl containing 3 mM MgCl2, 3.125 mM of each dNTP, 1xbuffer (20 mM Tris–HCl (pH 8.4), 50 mM KCl), 2.5 U of Taq Polymerase (Gibco BRL) and 5 µl of 10x primers for the IL6R and G3PDH (MBI, San Francisco). For the IL6 (accession number M14584 [GenBank] ) RT-PCR 0.8 µM of both primers were used (upstream: CACAGACAGCCACTCACCTCTTC (sequence location 190–212); downstream CTGCGCAGAATGAGATGAGTTGTC (sequence location 630–653). Product size was 464 bp (IL6), 300 bp (IL6R) and 921 (G3PDH). Amplification was carried out in a Biometra UNO thermocycler (Biometra, Göttingen, Germany) after an initial denaturation at 96°C for 2 min for 35 cycles using the following temperature and time profile: denaturation at 94°C for 1 min; primer annealing at 55°C for 2.5 min; primer extension at 70°C for 20 s; and a final extension of 70°C for 10 min. Aliquots of the PCR reaction products were analyzed using standard agarose gel electrophoresis, a video documentation system, and ImageQuant software (Molecular Dynamics, Krefeld, Germany).

2.7. Statistics
For statistical analysis, the Statistical Package for the Social Sciences (SPSS 9.0, Chicago, US) was used. Whenever a normal distribution of parameters could not be assumed, descriptive statistical analysis was performed using the median and rank values. Correlations between OD ratios of cytokine/G3PDH mRNA and hemodynamic and echocardiographic parameters were calculated using linear regression analysis. Differences between lower and upper half of cytokine data using medians for dichotomization were assessed by Mann–Whitney-test for independent samples. P-values of less than 0.05 were considered significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1. Cardiac IL6 gene expression pattern
As demonstrated by Northern blot analysis, all ventricular samples from patients with heart failure showed IL6 mRNA expression. Expression levels (OD ratios of IL6/G3DPH mRNA) of ventricular IL6 mRNA are summarized in Table 2. Right ventricular IL6 mRNA levels were higher than those found in left ventricles [OD ratio of IL6/G3DPH mRNA: LV=0.69 (0.48/1.20) to RV=1.86 (0.54/2.97); P=0.04].

The difference in expression of the IL6 gene between patient and control samples was evaluated by RT-PCR. Expression levels detected in right and left ventricles of failing hearts were markedly increased (Fig. 1 (bottom); P<0.001 vs. control). IL6 mRNA was not expressed in right ventricular septum of patients with arrhythmic disease. The OD ratio of IL6/G3DPH were: LV=3.3±3.1, RV=2.2±1.2 (P=not significant). A representative RT-PCR for IL6 and G3PDH mRNA is shown in Fig. 1 (top).


Figure 1
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Representative gel electrophoresis after RT-PCR and expression levels of IL6 mRNA. (top) In comparison with control tissue (right ventricular septum from patients with arrhythmias) which did not express IL6 mRNA, right ventricles of failing hearts showed strong IL6 mRNA signals. (bottom) Expression levels of IL6 were corrected for G3PDH levels (OD: IL6/G3PDH). Both right and left ventricles of failing hearts showed increased IL6 mRNA levels (vs. control P<0.001). Abbreviations: CRTL, control; FH, failing heart; LV, left ventricle; RV, right ventricle; G3PDH, glyceraldehyde-3-phosphate-dehydrogenase standard. 1–4, represent four different samples.

 
In situ hybridization allowed to evaluate the distribution of the IL6 mRNA expressing cells (Fig. 2a) and quantification of the signal area (Fig. 2b). In control samples, IL6 mRNA expressing cells were found only sporadically. Expressing cell types were mainly of spherical phenotype, most probably infiltrating cells. Ventricular samples of failing hearts showed increased numbers of IL6 mRNA expressing cells in interstitial tissue and myocardium. Signal area did not differ between sections hybridized with the sense IL6 probe (5.4±8.2 µm2) and control sections hybridized with the antisense IL6 probe (13.1±10.0 µm2). Corresponding to the results of RT-PCR, the signal area of ventricles from failing hearts was dramatically increased (172.9±49.5 µm2; vs. control tissue, P<0.001).


Figure 2
View larger version (82K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 (a) Representative in situ hybridization demonstrating IL6 mRNA expressing cells in control heart samples (CRTL) and in failing hearts (FH). Sections hybridized with the digoxigenin-labeled IL6 sense cRNA probe (IL6 sense) demonstrate the background signal (IL6 antisense CRTL 1 and 2). Sporadically, few IL6 mRNA expressing cells were detected in control tissue samples (biopsies of endomyocardial right ventricular septum of patients with arrhythmias) hybridized with IL6 antisense cRNA probe. Failing hearts (FH 1 and 2) showed markedly increased numbers of IL6 mRNA expressing cells. (b) Evaluation of the IL6 signal area revealed a 10-fold increased IL6 signal area (P<0.001) in failing hearts (FH; n=5) as compared to control tissue (n=11). Signal areas did not differ significantly between sense controls (sense) and the control tissue (CRTL).

 
3.2. Cardiac IL6 gene expression and cardiac function
Left ventricular IL6 mRNA levels correlated with heart rate (r=0.77; P=0.009), pulmonary capillary wedge pressure (r=0.53; P=0.03), mean pulmonary artery pressure (r=0.47; P=0.07), right atrial pressure (r=0.77; P=0.003), and inversely with left ventricular ejection fraction (r=–0.61; P=0.03). By analyzing in a dichotomous way, in patients with an IL6 mRNA expression above the median, there was a lower left ventricular ejection fraction (P=0.004). Right ventricular IL6 mRNA correlated inversely with cardiac index (r=–0.48; P=0.05).

3.3. Cardiac IL6R gene expression pattern
As demonstrated by RT-PCR, IL6R mRNA was not expressed in control samples whereas IL6R mRNA was detected in ventricular tissue of all patient samples examined (OD ratio of IL6/G3DPH: LV=1.7±0.7, RV=1.9±1.0; P<0.001 vs. control). A representative gel electrophoresis after RT-PCR is shown in Fig. 3. A correlation between IL6R gene expression and parameters of heart function was not observed.


Figure 3
View larger version (65K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Representative gel electrophoresis after RT-PCR and expression levels of IL6R mRNA. (top) In comparison with control tissue (right ventricular septum from patients with arrhythmias) which did not express IL6R mRNA, right ventricles of failing hearts showed strong IL6R mRNA signals. (bottom) Expression levels of IL6 were corrected for G3PDH levels (OD: IL6/G3PDH). Both right and left ventricles of failing hearts showed increased IL6R mRNA levels (vs. control P<0.001). Differences between the ventricles were not observed. Abbreviations: CRTL, control; FH, failing heart; LV, left ventricle; RV, right ventricle; G3PDH, glyceraldehyde-3-phosphate-dehydrogenase standard. 1–4, represent four different samples.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
This study demonstrates an elevated expression of cardiac IL6 and IL6R mRNA levels in patients with advanced heart failure undergoing transplantation and its potential pathophysiological significance.

To obtain appropriate control cardiac tissue, we chose to utilize right ventricular specimens of patients with complex ventricular arrhythmias and preserved cardiac function. In contrast to hearts of brain dead donors, an upregulation of proinflammatory cytokines should not be expected in this tissue. As demonstrated recently [27], TNF{alpha} expression is upregulated in donor hearts and correlates with right ventricular donor heart dysfunction. Furthermore, as shown by our laboratory, donor heart IL6 mRNA levels are also elevated (unpublished data). As compared with appropriate control tissue, our data demonstrate that the cardiac IL6 gene and the IL6R gene are upregulated in advanced heart failure. These data are in line with previous reports that human myocardium might produce IL6 in situations like myocardial infarction [19], ischemia [20], reperfusion [21], and rejection [22,23], as well as canine [28] and rat [11] data showing induction of the IL6 gene in the myocardium following ischemia.

An interesting pattern emerged by correlating ventricular IL6 mRNA expression with determinants of cardiac performance. Ventricular IL6 mRNA expression correlated positively with reduced left ventricular ejection fraction and cardiac index, elevated pulmonary capillary wedge pressure, right atrial pressure, and heart rate. Until now, only circulating IL6 protein levels have been correlated with hemodynamic and clinical data in heart failure patients [35]. In addition, pulmonary arterial pressure, right atrial pressure, and heart rate correlate with systemic venous IL6 plasma levels after cardiac operations with extracorporeal circulation and after heart transplantation [14,15]. Taken together, these data support the hypothesis that IL6 may be pathophysiologically linked to impaired function in advanced heart failure by influencing critical determinants of cardiac performance systemically and additionally via a cardiac pathway.

This notion is backed by reports showing a direct negative inotropic effect of proinflammatory cytokines on the myocardium in experimental models utilizing feline cardiomyocyte preparations [13] and hamster papillary preparations [9,29]. Our results are in concordance with these experimental findings. Further support of the hypothesis is derived from recent studies involving genetically engineered mice. Transgenic mice overexpressing the signal-transducing receptor component gp130 which is shared by all IL6 cytokine family members [7] develop hypertrophy of ventricular myocardium [16]. On the other hand, in the absence of the gp130 signal transduction pathway, a dilated cardiomyopathic phenotype results [17]. Recently, it has been demonstrated in mice harboring a ventricular restricted knockout of the gp130 cytokine receptor that the intraventricular gp130 signal transduction pathway is critical in mediating the compensatory myocardial growth response to pressure overload of the myocardium following transverse aortic constriction [18]. In summary, these data are in line with the concept of heart failure as a ‘cardiomyopathy of overload’ [30] and suggest a role for the cardiac IL6 system in its development. Consequently, a reversal of IL6 expression in the left ventricle of advanced heart failure patients has been observed after chronic unloading during left ventricular assist device support [31]. The precise role of the IL6 system, specifically the gp130-dependent signaling (JAK/STAT3 and MAPK), in the remodeling process needs to be addressed in additional mechanistic studies, e.g. utilizing the ventricular restricted gp130-knockout model.

4.1. Limitations
The assessment of functional parameters and expression levels of the IL6 system could not be performed simultaneously. Thus, potential changes over time could not be taken into consideration and these correlations have to be confirmed to further studies. Another shortcoming of this study is the lack of protein expression data, correlation between IL6/IL6R expression and neurohormones, myocyte density/hypertrophy and fibrosis. Furthermore, an interaction between serum IL6 receptors and IL6 was not examined.

4.2. Conclusions
In summary, we have demonstrated elevated IL6 and IL6R gene expression in ventricular myocardium of advanced heart failure patients. The cardiac IL6 system may play a role in the pathophysiology of advanced heart failure.


    Acknowledgements
 
We are indebted to Brigitta Weißen, Marianne Opalka and Dorothee Reichenberg for excellent technical assistance. This work was supported by a grant of the German Research Agency (Deutsche Forschungsgemeinschaft De 530/3-1).


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Levine B., Kalman J., Mayer L., Fillit H.M., Packer M. Elevated circulating levels of tumor necrosis factor in severe chronic heart failure. N Engl J Med (1990) 323:236–241.[Abstract]
  2. Mann D.L., Young J.B. Basic mechanisms in congestive heart failure: recognizing the role of proinflammatory cytokines. Chest (1994) 105:897–904.[CrossRef][Web of Science][Medline]
  3. Munger M.A., Johnson B., Amber I.J., et al. Circulating concentrations of proinflammatory cytokines in mild or moderate heart failure secondary to ischemic or idiopathic dilated cardiomyopathy. Am J Cardiol (1996) 77:723–727.[CrossRef][Web of Science][Medline]
  4. Torre-Amione G., Kapadia S., Benedict C., et al. Proinflammatory cytokine levels in patients with depressed left ventricular ejection fraction: a report from the studies of left ventricular dysfunction (SOLVD). J Am Coll Cardiol (1996) 27:1201–1206.[Abstract]
  5. Deng M.C., Erren M., Lütgen A., et al. Interleukin-6 correlates with hemodynamic impairment during dobutamine administration in chronic heart failure. Int J Cardiol (1996) 57:129–134.[CrossRef][Web of Science][Medline]
  6. Tsutamoto T., Hisanaga T., Wada A., et al. Interleukin-6 spillover in the peripheral circulation increases with the severity of heart failure, and the high plasma level of interleukin-6 is an important predictor in patients with congestive heart failure. J Am Coll Cardiol (1998) 31:391–398.[Abstract/Free Full Text]
  7. Taga T., Kishimoto T. Gp130 and the interleukin-6 family of cytokines. Annu Rev Immunol (1997) 15:797–819.[CrossRef][Web of Science][Medline]
  8. Aukrust P., Ueland T., Lien E., et al. Cytokine network in congestive heart failure secondary to ischemic or idiopathic dilated cardiomyopathy. Am J Cardiol (1999) 83:376–382.[CrossRef][Web of Science][Medline]
  9. Finkel M.S., Oddis C.V., Jacob T.D., et al. Negative inotropic effects of cytokines on the heart mediated by nitric oxide. Science (1992) 257:387–389.[Abstract/Free Full Text]
  10. Finkel M.S., Hoffman R.A., Shen L., et al. Interleukin-6 (IL-6) as a mediator of stunned myocardium. Am J Cardiol (1993) 71:1231–1233.[CrossRef][Web of Science][Medline]
  11. Prabhu S.D., Chandrasekar B., Murray D.R., Freeman G.L. Beta-adrenergic blockade in developing heart failure: effects on myocardial inflammatory cytokines, nitric oxide, and remodeling. Circulation (2000) 101(17):2103–2109.[Abstract/Free Full Text]
  12. Gulick T., Chung M.K., Pieper S.J., et al. Immune cytokine inhibition of beta-adrenergic agonist stimulated cyclic AMP generation in cardiac myocytes. Biochem Biophys Res Commun (1988) 150:1–9.[CrossRef][Web of Science][Medline]
  13. Oral H., Dorn G.W., Mann D.L. Sphingosine mediates the immediate negative inotropic effects of tumor necrosis factor-alpha in the adult mammalian cardiac myocyte. J Biol Chem (1997) 272:4836–4842.[Abstract/Free Full Text]
  14. Deng M.C., Kämmerling L., Erren M., et al. Relation of interleukin(IL)-6, tumor-necrosis factor-{alpha}, IL-2, and IL-2-receptor-levels to cellular rejection, allograft dysfunction and mortality early after cardiac transplantation. Transplantation (1995) 60:1118–1124.[CrossRef][Web of Science][Medline]
  15. Deng M.C., Dasch B., Erren M., et al. Impact of left ventricular dysfunction on cytokines, hemodynamics and outcome in bypass surgery. Ann Thorac Surg (1996) 62:184–190.[Abstract/Free Full Text]
  16. Hirota H., Yoshida K., Kishimoto T., et al. Continuous activation of gp130, a signal-transducing receptor component for interleukin 6-related cytokines, causes myocardial hypertrophy in mice. Proc Natl Acad Sci USA (1995) 92:4862–4866.[Abstract/Free Full Text]
  17. Yoshida K., Taga T., Saito M., et al. Targeted disruption of gp130, a common signal transducer for the IL-6-family of cytokines, leads to myocardial and hematological disorders. Proc Natl Acad Sci (1996) 93:407–411.[Abstract/Free Full Text]
  18. Hirota H., Chen J., Betz U.A.K., et al. Loss of a gp130 cardiac muscle cell survival pathway is a critical event in the onset of heart failure during biomechanical stress. Cell (1999) 97:189–198.[CrossRef][Web of Science][Medline]
  19. Neumann F.-J., Ott I., Gawaz M., et al. Cardiac release of cytokines and inflammatory responses in acute myocardial infarction. Circulation (1995) 92:748–755.[Abstract/Free Full Text]
  20. Biasucci L.M., Vitelli A., Liuzzi G., et al. Elevated levels of interleukin-6 in unstable angina. Circulation (1996) 94:874–877.[Abstract/Free Full Text]
  21. Wan S., DeSmet J.M., Barvais L., et al. Myocardium is a major source of proinflammatory cytokines in patients undergoing cardiopulmonary bypass. J Thorac Cardiovasc Surg (1996) 112:806–811.[Abstract/Free Full Text]
  22. Cunningham D.A., Dunn M.J., Yacoub M.H., et al. Local production of cytokines in the human cardiac allograft: a sequential study. Transplantation (1994) 57:1333–1337.[CrossRef][Web of Science][Medline]
  23. Lagoo A.S., George J.F., Naftel D.C., et al. Semiquantitative measurement of cytokine messenger RNA in endomyocardium and peripheral blood mononuclear cells from human heart transplant recipients. J Heart Lung Transplant (1996) 15:206–217.[Web of Science][Medline]
  24. Plenz G., Song Z.F., Reichenberg S., et al. Higher left ventricular interleukin-6-messenger-RNA expression in idiopathic dilated than in ischemic cardiomyopathy. Thorac Cardiovasc Surgeon (1998) 46:213–216.[Web of Science][Medline]
  25. Chirgwin J.M., Przybyla A.E., McDonald R.J., et al. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry (1979) 18:5294–5299.[CrossRef][Web of Science][Medline]
  26. Plenz G., Koenig C., Severs N.J., et al. Smooth muscle cells express granulocyte-macrophage colony stimulating factor (GM-CSF) in the undiseased and atherosclerotic human coronary artery. Arterioscl Throm Vasc Biol (1997) 17:2489–2499.[Abstract/Free Full Text]
  27. Birks E.J., Owen V.J., Burton P.B.J., et al. Tumor necrosis factor-{alpha} is expressed in donor heart and predicts right ventricular failure after human heart transplantation. Circulation (2000) 102:326–331.[Abstract/Free Full Text]
  28. Kukielka G.L., Smith C.W., Manning A.M., et al. Induction of interleukin-6 synthesis in the myocardium. Potential role in postreperfusion inflammatory injury. Circulation (1995) 92:1866–1975.[Abstract/Free Full Text]
  29. Balligand J.L., Ungureanu D., Kelly R.A., et al. Abnormal contractile function due to induction of nitric oxide synthesis in rat cardiac myocytes follows exposure to activated macrophage-conditioned medium. J Clin Invest (1993) 91:2314–2319.[Web of Science][Medline]
  30. Katz A.M. The cardiomyopathy of overload: An unnatural growth response in the hypertrophied heart. Ann Intern Med (1994) 121:363–371.[Abstract/Free Full Text]
  31. Plenz G., Baba H.A., Erren M., et al. Reversal of myocardial interleukin-6-mRNA expression following longterm left ventricular assist device support for myocarditis-associated low output syndrome. J Heart Lung Transplant (1999) 18:923–924.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Anesth. Analg.Home page
M. Sander, C. von Heymann, V. v. Dossow, C. Spaethe, W. F. Konertz, U. Jain, and C. D. Spies
Increased interleukin-6 after cardiac surgery predicts infection.
Anesth. Analg., June 1, 2006; 102(6): 1623 - 1629.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
C. Avgeropoulou, I. Andreadou, S. Markantonis-Kyroudis, M. Demopoulou, P. Missovoulos, A. Androulakis, and I. Kallikazaros
The Ca2+-sensitizer levosimendan improves oxidative damage, BNP and pro-inflammatory cytokine levels in patients with advanced decompensated heart failure in comparison to dobutamine
Eur J Heart Fail, August 1, 2005; 7(5): 882 - 887.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
M Vanderheyden, W J Paulus, M Voss, P Knuefermann, N Sivasubramanian, D Mann, and G Baumgarten
Myocardial cytokine gene expression is higher in aortic stenosis than in idiopathic dilated cardiomyopathy
Heart, July 1, 2005; 91(7): 926 - 931.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart J SupplHome page
T. Bachetti, L. Comini, E. Pasini, and R. Ferrari
Anti-cytokine therapy in chronic heart failure: new approaches and unmet promises
Eur. Heart J. Suppl., November 1, 2004; 6(suppl_F): F16 - F21.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
R. Gaertner, D. Lepailleur-Enouf, W. Gonzalez, A. Nicoletti, C. Mandet, M. Philippe, J.-J. Mercadier, and J.-B. Michel
Pulmonary endothelium as a site of synthesis and storage of interleukin-6 in experimental congestive heart failure
Eur J Heart Fail, August 1, 2003; 5(4): 435 - 442.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Yin, P. Li, M. Zheng, L. Chen, Q. Xu, K. Chen, Y.-y. Wang, Y.-y. Zhang, and C. Han
Interleukin-6 Family of Cytokines Mediates Isoproterenol-induced Delayed STAT3 Activation in Mouse Heart
J. Biol. Chem., May 30, 2003; 278(23): 21070 - 21075.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
M. Jougasaki, H. Leskinen, A. M. Larsen, A. Cataliotti, H. H. Chen, and J. C. Burnett Jr.
Leukemia inhibitory factor is augmented in the heart in experimental heart failure
Eur J Heart Fail, March 1, 2003; 5(2): 137 - 145.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
D. C.H Ng, N. W Court, C. G dos Remedios, and M. A Bogoyevitch
Activation of signal transducer and activator of transcription (STAT) pathways in failing human hearts
Cardiovasc Res, February 1, 2003; 57(2): 333 - 346.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
R. Sirera, A. Salvador, I. Roldan, R. Talens, A. Gonzalez-Molina, and M. Rivera
Quantification of proinflammatory cytokines in the urine of congestive heart failure patients. Its relationship with plasma levels
Eur J Heart Fail, January 1, 2003; 5(1): 27 - 31.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
G. Plenz, H. Eschert, M. Erren, T. Wichter, M. Bohm, M. Flesch, H. H. Scheld, and M. C. Deng
The interleukin-6/interleukin-6-receptorsystem is activated in donor hearts
J. Am. Coll. Cardiol., May 1, 2002; 39(9): 1508 - 1512.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Plenz, G.
Right arrow Articles by Deng, M. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Plenz, G.
Right arrow Articles by Deng, M. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?