Skip Navigation

European Journal of Heart Failure 2000 2(4):379-386; doi:10.1016/S1388-9842(00)00104-5
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Luchner, A.
Right arrow Articles by Redfield, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luchner, A.
Right arrow Articles by Redfield, M. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2000 European Society of Cardiology

Relationship between left ventricular wall stress and ANP gene expression during the evolution of rapid ventricular pacing-induced heart failure in the dog

Andreas Luchnera,*, Daniel D. Borgesonb, James A. Granthamb, Erik Friedricha, Günter A.J. Rieggera, John C. Burnett, Jrb and Margaret M. Redfieldb

a Klinik und Poliklinik für Innere Medizin II, Universität Regensburg F.J. Strauss Allee 11, 93042 Regensburg, Germany
b Cardiorenal Research Laboratory, Division of Cardiovascular Diseases, Mayo Clinic Rochester, MN, USA

* Corresponding author. Tel.: +49-941-944-0; fax: +49-941-944-7339. E-mail: andreas.luchner{at}klinik.uni-regensburg.de (A. Luchner).


   Abstract
Top
 Abstract
1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
We have recently described a modified model of progressive rapid ventricular pacing-induced heart failure which evolves over a period of 38 days. To further characterize left ventricular remodeling during the progression of heart failure, we assessed left ventricular geometry, wall stress, and atrial natriuretic peptide (ANP) gene expression and protein content during control conditions, asymptomatic left ventricular dysfunction, and overt congestive heart failure (CHF). Although asymptomatic left ventricular dysfunction was characterized by a significant increase in systolic and diastolic left ventricular dimension (+30% and +6%, respectively, P<0.05 each) and a marked increase in left ventricular systolic wall stress (+68%, P<0.01), left ventricular ANP gene expression was unchanged as compared to control. In contrast, strong left ventricular ANP gene expression (+449%, P<0.05) was observed during overt CHF in the absence of further significant increases in left ventricular systolic wall stress. The onset of strong left ventricular ANP gene expression was associated with increased ANP content (+88%, P<0.05) and left ventricular mass index (+13%, P<0.05). In contrast, left atrial ANP gene expression and left ventricular diastolic wall stress increased progressively during asymptomatic left ventricular dysfunction (+39%, P=n.s. and +131%, P<0.01) and overt CHF (+76% and +336% vs. control, P<0.01 each). Progressive rapid ventricular pacing is associated with the induction of left ventricular ANP gene expression and protein synthesis exclusively during overt CHF. The current studies provide new insight into the temporal pattern of ANP-activation and the disparity between left ventricular systolic wall stress and ANP-activation in a large animal model of progressive CHF.

Key Words: LV hypertrophy • Pacing • Dog • Gene

Received November 12, 1999; Revised June 8, 2000; Accepted June 20, 2000


   1. Introduction
Top
 Abstract
 1. Introduction
2. Methods
 3. Results
 4. Discussion
 References
 
Atrial natriuretic peptide (ANP) is a circulating hormone of cardiac origin whose biological actions include promotion of natriuresis and vasodilatation [1,2], inhibition of growth, and suppression of the renin–angiotensin [1,3,4] and endothelin-1 (ET-1) systems [5]. Under normal conditions, expression of ANP mRNA is dominant in atrial myocytes [6–8] and ANP is released from secretory granules in response to atrial stretch [9]. In addition, the presence of ANP has been demonstrated in hypertrophied ventricular myocardium [10–12] and in severe CHF [13,14]. However, temporal changes of left ventricular ANP-expression during the progression of heart failure are currently not well documented.

Rapid ventricular pacing-induced CHF is a model of heart failure which has provided important insights into mechanisms of the syndrome. In dogs, this model has traditionally been carried out utilizing straight pacing rates of 240 or 250 beats per minute for 14–28 days [15,16]. These protocols result in severely impaired systolic and diastolic left ventricular function and marked chamber dilatation in the absence of left ventricular hypertrophy [7,16–19] or altered left ventricular ANP gene expression [7]. The absence of left ventricular hypertrophy has been cited as a limitation of the model.

We recently modified the traditional model and have developed a model which, due to incremental pacing from 180 to 240 beats per minute, evolves from asymptomatic left ventricular dysfunction to overt congestive heart failure over a period of 38 days [20]. This model of progressive left ventricular dysfunction has yielded insight into the evolution of local and circulating neurohormonal activation during the evolution of CHF [21,20] and, unlike the traditional model, is characterized by a significant increase in left ventricular mass evident at the phase of overt CHF [20]. However, the temporal evolution of left ventricular activation of ANP and its relation to hemodynamic stimuli (increased wall stress) during the progression of pacing-induced CHF has not been defined yet.

It was therefore the objective of the current investigation to characterize left ventricular ANP gene expression in association with left ventricular wall stress during progressive rapid ventricular pacing. We hypothesized that an increased ANP gene expression might not be present in the early phase, but might accompany increases in left ventricular mass in the terminal phase of the model.

To address this hypothesis, we synthesized a partial cDNA to canine ANP and assessed ANP gene expression in atrial and ventricular myocardium, cardiac tissue ANP concentrations, and left ventricular wall stress in normal dogs, dogs with asymptomatic left ventricular dysfunction and dogs with overt CHF.


   2. Methods
Top
 Abstract
 1. Introduction
 2. Methods
3. Results
 4. Discussion
 References
 
2.1. Study protocol
Sixteen male mongrel dogs were used for the study. Eleven dogs underwent implantation of a programmable cardiac pacemaker (Medtronic, Minneapolis, MN, USA). Under pentobarbital sodium anesthesia (30 mg/kg i.v.) and artificial ventilation (Harvard respirator, Harvard Apparatus, Millis, MA, USA), the heart was exposed via a left lateral thoracotomy and pericardiotomy and a screw-in epicardial pacemaker lead was implanted into the right ventricle. The pacemaker was implanted subcutaneously into the left chest wall and connected to the pacemaker lead. Six of the dogs also underwent implantation of a chronic catheter in the left femoral artery, connected to a subcutaneous port above the left upper hind limb (Model GPV Vascular-Access Port, Access Technologies, Skokie, IL, USA). All dogs were allowed to recover for at least 10 days after surgery before the pacemaker was started for the induction of heart failure.

Six dogs (overt CHF group) underwent pacing with a stepwise increase of stimulation frequencies over 38 days as described previously [20,21]. During the first 10 days, animals were paced at 180 beats per minute (bpm). This protocol results in asymptomatic left ventricular dysfunction as defined by significant systolic dysfunction with decreased cardiac output, cardiac enlargement and increased filling pressures but maintained systemic perfusion pressure and renal sodium excretion and no clinical signs of heart failure [22,23]. The pacing rate was then increased weekly to 200, 210, 220 and 240 bpm and asymptomatic left ventricular dysfunction evolved to overt CHF, characterized by further decreased cardiac output, decreased systemic perfusion pressure, renal sodium retention, and clinical symptoms such as ascites, exercise intolerance, loss of appetite, and cachexia [20]. All pacemakers were checked at the time of programming and then weekly for proper pacing. Prior to the commencement of pacing, after 10 days of pacing at 180 bpm (asymptomatic left ventricular dysfunction), and at the end of the pacing protocol (overt CHF), dogs were briefly anesthetized and a Swan-Ganz catheter was inserted via the jugular veins. After recovery from anesthesia, cardiac output was assessed by thermodilution (American Edwards Laboratories, model 9510-A). Right atrial pressure (RAP), pulmonary capillary wedge pressure (PCWP), and systolic, diastolic and mean arterial pressure (SAP, DAP and MAP, respectively) were recorded on a strip-chart recorder. A 2-D guided M-mode echocardiogram was obtained with the pacemaker deprogrammed and arterial blood was drawn from the port. Blood was collected in EDTA tubes and immediately placed on ice.

After the 38-day pacing protocol (overt CHF), these dogs were killed (Sleepaway euthanasia solution i.v., Fort Dodge Laboratories Inc., Fort Dodge, IA, USA) for rapid tissue harvesting. Hearts were rapidly trimmed, weighed, and tissue samples from the left ventricular free wall and the left atrial auricle snap frozen in liquid nitrogen and stored at –80°C. Blood was centrifuged at 2500 rev./min and 4°C and the plasma stored at –20°C until analysis as described below. A second group of five dogs was paced at 180 bpm for 10 days only and served as tissue donor for the asymptomatic left ventricular dysfunction group. Again, all dogs were checked repeatedly for proper pacing and hemodynamic measurements were obtained to document cardiac dysfunction. A third group of five healthy normal dogs served as tissue donor for the control group.

All studies were approved by the Institutional Animal Care and Use Committee of the Mayo Clinic and conducted in accordance with the Animal Welfare Act.

2.2. Quantification of ANP
Plasma and tissue ANP was determined by standard radioimmunoassay (RIA) technique [24]. To extract tissue ANP, samples were pulverized frozen, boiled for 5 min in 10 volumes of 1 M acetic acid/20 mM HCl and homogenized at high speed (PT 1200, Polytron). The homogenate was then ultracentrifuged at 27 000xg at 4°C and the supernatant stored at –20°C until RIA [7]. Prior to centrifugation, a sample of the homogenate was taken for measurement of tissue protein content according to the Folin Phenol Method by Lowry et al. [25]. Immunoreactive ANP in tissue was measured as pg/ml homogenate, normalized for protein content and expressed as pg ANP/mg tissue protein.

2.3. ANP gene expression
For analysis of myocardial ANP gene expression, mRNA was extracted utilizing a commercially available kit (Fasttrack, Invitrogen). Briefly, tissue was homogenized (Polytron PT 1200) in a detergent-based buffer containing RNAase/Protein degrader and incubated in a slow-shaking waterbath. DNA was precipitated and sheared and Oligo (dT) Cellulose was added for adsorption of polyadenylated mRNA. DNA, proteins, cell debris and non-polyadenylated RNA were washed off and mRNA eluted off the Oligo (dT) Cellulose. The yield of mRNA was determined in a spectrophotometer by absorption of 260-nm UV-light. Approximately 5 µg mRNA per extract were loaded on a 1.2% agarose formaldehyde gel and electrophoresed for 2–3 h at 75 V. The gel was then blotted downward overnight (Turbo-Blotter, Schleicher & Schuell) onto a nylon membrane (Maximum Strength Nytran Membrane, Schleicher & Schuell).

As a probe for ANP mRNA, a 332-base-pair partial cDNA specific for canine ANP was synthesized. In brief, first-strand cDNA was reverse transcribed from canine atrial mRNA. Then, DNA-amplification was performed by polymerase chain reaction with 20-base oligomers as primers [19]. Amplification temperatures were 95°C for 60 s, 56°C for 120 s and 72°C for 180 s and 35 amplification cycles were performed. CAACGCAGACCTGCTGGATT was used as 5' primer and AGTCCGCTCTGGGCTCCAAT was used as 3' primer, corresponding to nucleotides 174–193 and nucleotides 487–506 of the cDNA to canine ANP mRNA, respectively [26]. The resulting DNA was electrophoresed in a 1% agarose gel, resulting in a single sharp band of the predicted length. This band was recovered from the gel and DNA sequencing was carried out. The resulting nucleotide sequence was identical to the predicted sequence, so confirming that the recovered DNA contained a specific cDNA to canine ANP mRNA.

For Northern hybridization, 50 µg of the canine-specific ANP probe were random primed with P32-dCTP (Random Primed DNA Labeling Kit, Boehringer Mannheim Biochemical) and column-purified. Membranes were pre-hybridized (QuickHyb Hybridization Solution, Stratagene) for 10 min at 68°C and then hybridized with the labeled probe for 80 min at 68°C. Membranes were then washed stringently (2xSSC/0.1% SDS at 22°C for 5 min, then 0.2xSSC/0.1% SDS at 22°C for 5 min, then 0.2xSSC/0.1% SDS at 55°C for 20 min) and exposed to an X-ray film overnight. To control for loading conditions and mRNA transfer onto the membranes, blots were re-hybridized with a GAPDH probe. The respective autoradiographic bands for ANP and GAPDH were quantified with a scanning spectrophotometer and ANP mRNA expressed in arbitrary units as ratio of autoradiographic densities of the ANP-band and the GAPDH-band.

2.4. Echocardiography
A short-axis echocardiogram (Toshiba, Japan) was performed by an expert echocardiographer from the right parasternal window. Left ventricular end-diastolic (LVEDd) and end-systolic (LVESd) dimensions and diastolic and systolic thicknesses of the left ventricular septum (SEDd and SESd) and posterior wall (PWEDd and PWESd) were determined from three repeated 2D guided M-mode tracings using ASE convention. From those measurements, ejection fraction (EF) was calculated as:


Formula

2.5. Calculation of wall stress
From the blood pressure recordings, three repeated tracings were used for the assessment of peak systolic arterial pressure (SAP), which was used as an estimate of left ventricular systolic pressure. Left ventricular systolic wall stress (LVSWS) was then calculated as [27,28]:


Formula

For the assessment of left ventricular diastolic wall stress (LVDWS), PCWP was used as substitute for left ventricular diastolic pressure. Left ventricular diastolic wall stress was calculated as:


Formula

2.6. Statistical analysis
Results of the quantitative studies were expressed as mean±standard error. Comparison between the control, asymptomatic left ventricular dysfunction and the overt CHF groups were performed by analysis of variance (ANOVA) followed by Fisher's least significant difference test. Statistical significance was defined as P<0.05.


   3. Results
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
4. Discussion
 References
 
3.1. Hemodynamics
In asymptomatic LV dysfunction, cardiac output and arterial pressure were decreased while pulmonary capillary wedge pressure was increased. In overt CHF, cardiac output and arterial pressure decreased further, together with a further increase in pulmonary capillary wedge pressure and right atrial pressure (see Table 1).


View this table:
[in this window]
[in a new window]

  		Table 1 Hemodynamic, echocardiographic, and neurohumoral characteristics during the progression to CHFa

 
3.2. Left ventricular geometry and wall stress
In asymptomatic left ventricular dysfunction, left ventricular end-systolic and end-diastolic dimensions were increased significantly and wall thickness showed a tendency to decrease. In overt CHF, left ventricular end-systolic and end-diastolic dimensions were increased further, accompanied by significant left ventricular wall thinning (Table 1). Systolic and diastolic wall stress were already markedly increased in asymptomatic left ventricular dysfunction (Fig. 1). In overt CHF, left ventricular diastolic wall stress increased further significantly, while systolic wall stress only had an insignificant tendency to increase further.


Figure 1
View larger version (6K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 Left ventricular end-diastolic (left) and peak systolic wall stress (right) during control conditions (Control), asymptomatic left ventricular dysfunction (ALVD), and overt CHF. Data expressed as mean±standard error. *P<0.05 vs. control, {dagger}P<0.05 vs. ALVD.

 
3.3. Neurohumoral activation
While plasma ANP was markedly increased in asymptomatic left ventricular dysfunction and Norepinephrine had a tendency to increase, ET-1 was unchanged as compared to control. In contrast, overt CHF was characterized by strong activation of both Norepinephrine and ET-1, as well as a further increase of ANP (see Table 1).

3.4. Cardiac ANP gene expression, protein content, and left ventricular mass
A positive signal for ANP mRNA was present in all left atrial samples from control, asymptomatic left ventricular dysfunction and overt CHF animals. In contrast, ANP mRNA was barely detectable in left ventricular samples from control and asymptomatic left ventricular dysfunction animals, while strong signals were present in all samples from overt CHF tissues. A representative autoradiography for ANP mRNA from each two control, asymptomatic left ventricular dysfunction, and overt CHF samples is depicted in Fig. 2.


Figure 2
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Representative Northern blot for each two control animals, animals with asymptomatic left ventricular dysfunction, and animals with overt CHF for left atrial and left ventricular tissues.

 
Quantitative analysis (Figs. 3 and 4) demonstrated that left ventricular ANP mRNA was unaltered during asymptomatic left ventricular dysfunction, while left atrial ANP mRNA showed a strong tendency to increase. Overt CHF was characterized by the onset of significant left ventricular transcription of ANP mRNA and an increase in left atrial ANP mRNA.


Figure 3
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Quantitative analysis of left atrial (LA) and left ventricular (LV) ANP mRNA during control conditions (white bar), asymptomatic left ventricular dysfunction (striped bar) and overt CHF (black bar). Data expressed as mean±standard error. *P<0.05 vs. control, {dagger}P<0.05 vs. asymptomatic left ventricular dysfunction.

 


Figure 4
View larger version (5K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 Relationship between peak left ventricular (LV) systolic wall stress and ANP gene expression in progressive rapid ventricular pacing-induced CHF.

 
ANP immunoreactivity was present in all tissues. While left ventricular ANP content was unchanged in asymptomatic left ventricular dysfunction as compared to control, overt CHF was characterized by a marked increase in left ventricular ANP (12.8±2.1 pg/mg protein vs. 6.8±2.0, P<0.03), together with a modest increase in left ventricular mass index (4.5±0.1 g/kg vs. 4.0±0.2, P<0.02).

Left atrial ANP concentrations exceeded left ventricular ANP and showed a tendency to increase during overt CHF (106.4±26.1 pg/mg protein vs. 81.6±27.0, P=n.s.).


   4. Discussion
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
References
 
The current study was designed to assess the relationship between hemodynamic stimuli and ANP gene expression and protein during the progression of left ventricular dysfunction in a modified model of CHF, produced by progressive rapid ventricular pacing. ANP gene expression was assessed by Northern analysis with a canine-specific cDNA. In control dogs, left ventricular ANP gene expression was barely detectable. In dogs with asymptomatic left ventricular dysfunction, there was a marked and significant increase in left ventricular systolic wall stress, which was, however, not associated with increased ANP gene expression. In contrast, strong left ventricular ANP gene expression, together with increased tissue ANP and increased left ventricular mass, were observed during overt CHF despite no further significant increase in systolic wall stress. Unlike left ventricular ANP gene expression, left atrial expression increased progressively throughout asymptomatic left ventricular dysfunction and overt CHF.

Left ventricular ANP gene expression has been described in a number of rodent models with left ventricular remodeling of different etiologies, including volume [13] and pressure overload [10,11]. In addition, it has been demonstrated that human hypertrophic cardiomyopathy and end-stage cardiomyopathy [13,14] are characterized by left ventricular ANP gene expression. The onset of increased ventricular ANP gene expression may occur within hours after the onset of elevated wall stress ex vivo [29] but remains controversial for progressive heart failure. Nevertheless, the marked up-regulation of left ventricular ANP gene expression during hemodynamic overload, as well as the presence of regulatory elements within the ANP gene which recognize the early-gene heterodimer c-fos/c-jun [30], have promoted the current utilization of ANP gene expression as molecular surrogate marker for left ventricular hypertrophy.

Until now, however, rapid ventricular pacing has been thought to be inherently associated with a lack of left ventricular hypertrophy [7,18,19] as well as a lack of activation of left ventricular ANP gene expression [7]. Increased expression of left ventricular ANP expression in rapid ventricular pacing-induced heart failure has so far been suggested only once [19] in a study were ANP mRNA was estimated after reverse transcription polymerase chain reaction from endocardial specimens of chronically instrumented dogs. However, the marginal increase of mean left ventricular ANP gene expression observed in this study was also characterized by scatter and outlying results. As discussed by the authors, appropriate statistical testing did therefore not result in significantly increased ANP expression. Furthermore, the finding was not confirmed by standard Northern analysis post mortem and may not be representative for left ventricular myocardium because of selective endocardial sampling. Therefore, the current study is the first to demonstrate strong and significant induction of ANP transcription by standard techniques in a model of rapid ventricular pacing-induced CHF.

The disparity between selective late onset of left ventricular ANP gene expression in the current large animal model and the previously demonstrated more rapid onset in rodent models also suggests species-specific differences in the mechanisms which activate ANP, possibly also including a greater resistance against elevated wall stress in larger species. With respect to human asymptomatic left ventricular dysfunction, it is therefore tempting to speculate that, similarly to asymptomatic pacing-induced left ventricular dysfunction, increased left ventricular systolic wall stress may precede the activation of ANP gene expression up to a threshold and the onset of broad humoral stimulation. To test this hypothesis, the presence or absence of increased left ventricular ANP expression in human asymptomatic left ventricular dysfunction remains to be assessed in clinical studies.

The mechanism for the temporal disparity between increased left ventricular systolic wall stress and onset of significant ANP gene expression may be related to neurohumoral modulation of the response to hemodynamic stimuli. Indeed, atrial production of ANP is markedly increased in asymptomatic left ventricular dysfunction and ANP has been shown to exert growth-inhibiting actions [31], which may inhibit the response of the ventricle to hemodynamic overload during the earlier phase of CHF. In contrast, growth-promoting neurohormones such as ET-1 and angiotensin II [32–34], which are activated in the overt CHF phase of the model [20,21], may facilitate the response to hemodynamic overload at this stage. This concept is emphasized by the observation that left ventricular systolic wall stress during the overt CHF phase is increased further by only 18% as compared to asymptomatic left ventricular dysfunction, a small increase which, by itself, is unlikely to trigger ANP expression (Fig. 4).

Despite the onset of strong left ventricular activation of ANP gene expression, left ventricular ANP concentrations are still widely exceeded by atrial ANP concentrations during overt CHF. This phenomenon most likely indicates a differential post-transcriptional processing of ANP in atrial and ventricular myocardium. In particular, it may suggest a greater capacity of atrial myocytes to store ANP and a constitutive secretion of ANP from ventricular myocytes. The finding of a stepwise increase of left atrial ANP expression throughout the progression of CHF confirms our previous report about left atrial ANP in traditional rapid ventricular pacing [7].

In summary, the current study characterizes activation of left atrial and ventricular ANP in relation to hemodynamic and neurohumoral stimuli in a modified large animal model of progressive, rapid ventricular pacing-induced CHF. It demonstrates a temporal pattern of activation of left ventricular ANP which occurs late during progressive CHF and is disparate from early increases in left ventricular systolic wall stress. The temporal disparity between increased left ventricular systolic wall stress and onset of increased ANP gene expression and synthesis demonstrates a significant resistance of larger mammalian left ventricular myocardium to activate ANP and also supports the concept of neurohumoral modulation of left ventricular ANP during the progression of CHF.


   Acknowledgements
 
The authors acknowledge outstanding assistance by Lawrence L. Aarhus, Ross A. Aleff, Denise M. Heublein, Sharon M. Sandberg and the Department of Veterinary Medicine. This work was supported by grants from the National Institutes of Health (HL-36634 and HL-07111), the Hearst Foundation, the Miami Heart Research Institute and the Mayo Foundation. Andreas Luchner is a recipient of a grant by the Deutsche Forschungsgemeinschaft (Lu 562/1-1, 2 and 3-1, 2).


   References
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Burnett J.C. Jr, Granger J.P., Opgenorth T.J. Effects of synthetic atrial natriuretic factor on renal function and renin release. Am J Physiol (1984) 247:F863–F866.[Web of Science][Medline]
  2. De Bold A.J., Borenstein H.B., Veress A.T., Sonnenberg H. A rapid and potent natriuretic response to intravenous injection of atrial myocardial extract in rats. Life Sci (1981) 28:89–94.[CrossRef][Web of Science][Medline]
  3. Itoh H., Pratt R.E., Dzau V.J. Interaction of atrial natriuretic polypeptide and angiotensin II on protooncogene expression and vascular cell growth. Biochem Biophys Res Commun (1991) 176:1601–1609.[CrossRef][Web of Science][Medline]
  4. Kawaguchi H., Sawa H., et al. Rapid communication: effect of atrial natriuretic factor on angiotensin converting enzyme. J Mol Cell Cardiol (1989) 21:959–961.[CrossRef][Web of Science][Medline]
  5. Wada A., Tsutamoto T., Maeda Y., Kanamori T., Matsuda Y., Kinoshita M. Endogenous atrial natriuretic peptide inhibits endothelin-1 secretion in dogs with severe congestive heart failure. Am J Physiol (1996) 270:H1819–H1824.[Medline]
  6. Ogawa Y., Nakao K., Mukoyama M., et al. Natriuretic peptides as cardiac hormones in normotensive and spontaneously hypertensive rats: The ventricle is a major site of synthesis and secretion of brain natriuretic peptide. Circ Res (1991) 69:491–500.[Abstract/Free Full Text]
  7. Perella M.A., Schwab T.R., O'Murchu B., et al. Cardiac atrial natriuretic factor during evolution of congestive heart failure. Am J Physiol (1992) 262:H1248–H1255.[Web of Science][Medline]
  8. Takahashi T., Allen P., Izumo S. Expression of A-, B-, and C-type natriuretic peptide genes in failing and developing human ventricles. Circ Res (1992) 71:9–17.[Abstract/Free Full Text]
  9. Edwards B.S., Zimmermann R.S., Schwab R.R., Heublein D.M., Burnett J.C. Jr. Atrial stretch, not pressure, is the principal determinant controlling the acute release of atrial natriuretic factor. Circ Res (1988) 62:191–195.[Abstract/Free Full Text]
  10. Arai H., Nakao K., Saito Y., et al. Augmented expression of atrial natriuretic polypeptide gene in ventricles of spontaneously hypertensive rats (SHR) and SHR-stroke prone. Circ Res (1988) 62:926–930.[Abstract/Free Full Text]
  11. Lee R.T., Bloch K.D., Pfeffer J.M., Pfeffer M.A., Neer E.J., Seidman C.E. Atrial natriuretic factor gene expression in ventricles of rats with spontaneous biventricular hypertrophy. J Clin Invest (1988) 81:431–434.[Web of Science][Medline]
  12. Mercadier J.J., Samuel J.L., Michel J.B., et al. Atrial natriuretic factor gene expression in rat ventricle during experimental hypertension. Am J Physiol (1989) 257:H979–H987.[Web of Science][Medline]
  13. Edwards B.S., Ackermann D.M., Lee M.E., Reeder G.S., Wold L.E., Burnett J.C. Jr. Identification of atrial natriuretic factor within ventricular tissue in hamsters and humans with congestive heart failure. JCI (1988) 81:82–86.[Web of Science][Medline]
  14. Yasue H., Obata S., Okamura K., et al. Increased secretion of atrial natriuretic polypeptide (ANP) from the left ventricle in patients with dilated cardiomyopathy. J Clin Invest (1989) 83:46–51.[Web of Science][Medline]
  15. Redfield M.M., Edwards B.S., McGoon M.D., Heublein D.M., Aarhus L.L., Burnett J.C. Jr. Failure of atrial natriuretic factor to increase with volume expansion in acute and chronic congestive heart failure in the dog. Circulation (1989) 80:651–657.[Abstract/Free Full Text]
  16. Riegger G., Liebau G. The renin–angiotensin–aldosterone system, antidiuretic hormone and sympathetic nerve activity in an experimental model of congestive heart failure in the dog. Clin Sci (1982) 62:465–469.[Web of Science][Medline]
  17. Coleman H., Taylor R., Pool P., et al. Congestive heart failure following chronic tachycardia. Am Heart J (1971) 81:790–798.[CrossRef][Web of Science][Medline]
  18. Shannon R.P., Komamura K., Shen Y.T., Bishop S.P., Vatner S.F. Impaired regional subendocardial coronary flow reserve in conscious dogs with pacing-induced heart failure. Am J Physiol (1993) 265:H801–H809.[Web of Science][Medline]
  19. Williams R.E., Kass D.A., Kawagoe Y., et al. Endomyocardial gene expression during development of pacing tachycardia-induced heart failure in the dog. Circ Res (1994) 75:615–623.[Abstract/Free Full Text]
  20. Stevens T.L., Borgeson D.D., Luchner A., Wennberg P.W., Redfield M.M., Burnett J.C. Jr. A modified model of tachycardia-induced cardiomyopathy: insights into humoral and renal adaptations. In: Pathophysiology of tachycardia-induced heart failure—Spinale F., ed. (1996) Armonk, NY: Futura Press.
  21. Luchner A., Stevens T.L., Borgeson D.D., et al. Angiotensin II in the evolution of experimental heart failure. Hypertension (1996) 28:472–477.[Abstract/Free Full Text]
  22. Redfield M.M., Aarhus L.L., Wright R.S., Burnett J.C. Jr. Cardiorenal and neurohumoral function in a canine model of early left ventricular dysfunction. Circulation (1993) 87:2016–2022.[Abstract/Free Full Text]
  23. Stevens T.L., Burnett J.C. Jr, Kinoshita M., Matsuda Y., Redfield M.M. A functional role for endogenous atrial natriuretic peptide in a canine model of early left ventricular dysfunction. J Clin Invest (1995) 95:1101–1108.[Web of Science][Medline]
  24. Burnett J.C. Jr, Kao P.C., Hu D.C., et al. Atrial natriuretic peptide elevation in congestive heart failure in the human. Science (1986) 231:1145–1147.[Abstract/Free Full Text]
  25. Lowry O.H., Rosebrough N.J., Farr L., Randall R.J. Protein measurement with the folin phenol reagent. J Biol Chem (1951) 192:265–272.
  26. Oikawa S., Imai M., Inuzuka C., Tawaragi Y., Nakazato H., Matsuo H. Structure of dog and rabbit precursors of atrial natriuretic polypeptides deduced from nucleotide sequence of cloned cDNA. Biochem Biophys Res Commun (1985) 132:892–899.[CrossRef][Web of Science][Medline]
  27. Grossmann W., Jones D., McLaurin L.P. Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest (1975) 56:56–64.[Web of Science][Medline]
  28. Reichek N., Wilson J., Sutton M., Plappert T., Goldberg S., Hirshfeld J. Noninvasive determination of left ventricular end-systolic stress: validation of the method and initial application. Circulation (1982) 65:99–108.[Free Full Text]
  29. Cornelius T., Holmer S., Müller F., Riegger G., Schunkert H. Regulation of the rat atrial natriuretic peptide gene after acute imposition of left ventricular pressure overload. Hypertension (1997) 30:1348–1355.[Abstract/Free Full Text]
  30. Rosenzweig A., Halazonetis T.D., Seidman J.G., Seidman C.E. Proximal regulatory domains of rat atrial natriuretic factor gene. Circulation (1991) 84:1256–1265.[Abstract/Free Full Text]
  31. Cao L., Gardner D.G. Natriuretic peptides inhibit DNA synthesis in cardiac fibroblasts. Hypertension (1995) 25:227–234.[Abstract/Free Full Text]
  32. Dostal D., Baker B. Angiotensin II stimulation of left ventricular hypertrophy in adult rat heart. Am J Hypertens (1992) 5:276–280.[Web of Science][Medline]
  33. Ito H., Hiroe M., Hirata Y., et al. Endothelin ET-A receptor antagonist blocks cardiac hypertrophy provoked by hemodynamic overload. Circulation (1994) 89:2198–2203.[Abstract/Free Full Text]
  34. Kaddoura S., Firth J.D., Boheler K.R., Sugden P.H., Poole Wilson P. Endothelin-1 is involved in norepinephrine-induced ventricular hypertrophy in vivo: acute effects of bosentan, an orally active, mixed ET-A and ET-B receptor antagonist. Circulation (1996) 93:2068–2079.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Cardiovasc ResHome page
A. Luchner, F. Muders, O. Dietl, E. Friedrich, F. Blumberg, A.A. Protter, G.A.J. Riegger, and D. Elsner
Differential expression of cardiac ANP and BNP in a rabbit model of progressive left ventricular dysfunction
Cardiovasc Res, August 15, 2001; 51(3): 601 - 607.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
C. Y.T. Hart, D. M. Meyer, H. D. Tazelaar, J. P. Grande, J. C. Burnett Jr, P. R. Housmans, and M. M. Redfield
Load Versus Humoral Activation in the Genesis of Early Hypertensive Heart Disease
Circulation, July 10, 2001; 104(2): 215 - 220.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Luchner, A.
Right arrow Articles by Redfield, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luchner, A.
Right arrow Articles by Redfield, M. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?